Incidental Mutation 'R2229:Agbl1'
ID239599
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission 040230-MU
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76433378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 448 (T448A)
Ref Sequence ENSEMBL: ENSMUSP00000103066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably benign
Transcript: ENSMUST00000026854
AA Change: T448A

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: T448A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107442
AA Change: T448A

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: T448A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: T700A
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: T700A

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166190
AA Change: T686A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754
AA Change: T686A

DomainStartEndE-ValueType
low complexity region 286 302 N/A INTRINSIC
Pfam:Peptidase_M14 737 871 7.4e-14 PFAM
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGCTGGCAGTGAATTCAAC -3'
(R):5'- CTGGAATCTCTGTAATGTTCCCAG -3'

Sequencing Primer
(F):5'- CTGGCAGTGAATTCAACTGTCTG -3'
(R):5'- GTAATGTTCCCAGAAAAACCTCTTGC -3'
Posted On2014-10-15