Incidental Mutation 'R2225:Tnnt2'
ID239648
Institutional Source Beutler Lab
Gene Symbol Tnnt2
Ensembl Gene ENSMUSG00000026414
Gene Nametroponin T2, cardiac
SynonymscTnT, Tnt, cardiac TnT
MMRRC Submission 040226-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2225 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135836354-135852260 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 135843791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027671] [ENSMUST00000112085] [ENSMUST00000112086] [ENSMUST00000112087] [ENSMUST00000178204] [ENSMUST00000178854] [ENSMUST00000179863] [ENSMUST00000188028] [ENSMUST00000189355] [ENSMUST00000189732] [ENSMUST00000189826] [ENSMUST00000190451]
Predicted Effect probably benign
Transcript: ENSMUST00000027671
SMART Domains Protein: ENSMUSP00000027671
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 234 1e-33 PFAM
Pfam:Troponin 226 289 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112085
SMART Domains Protein: ENSMUSP00000107715
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 20 54 N/A INTRINSIC
Pfam:Troponin 100 238 2.4e-33 PFAM
Pfam:Troponin 230 293 2.7e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112086
AA Change: D19G
SMART Domains Protein: ENSMUSP00000107716
Gene: ENSMUSG00000026414
AA Change: D19G

DomainStartEndE-ValueType
low complexity region 3 58 N/A INTRINSIC
Pfam:Troponin 106 244 2.5e-33 PFAM
Pfam:Troponin 236 299 2.8e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112087
AA Change: D19G
SMART Domains Protein: ENSMUSP00000107717
Gene: ENSMUSG00000026414
AA Change: D19G

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:Troponin 106 250 1.1e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000178204
AA Change: D23G
SMART Domains Protein: ENSMUSP00000137579
Gene: ENSMUSG00000026414
AA Change: D23G

DomainStartEndE-ValueType
coiled coil region 1 38 N/A INTRINSIC
Pfam:Troponin 110 245 3.8e-34 PFAM
Pfam:Troponin 238 300 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178854
SMART Domains Protein: ENSMUSP00000136265
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000179863
AA Change: D23G
SMART Domains Protein: ENSMUSP00000137093
Gene: ENSMUSG00000026414
AA Change: D23G

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186225
Predicted Effect unknown
Transcript: ENSMUST00000188028
AA Change: D23G
SMART Domains Protein: ENSMUSP00000140941
Gene: ENSMUSG00000026414
AA Change: D23G

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189355
SMART Domains Protein: ENSMUSP00000139919
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 240 1.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189732
SMART Domains Protein: ENSMUSP00000139669
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000189826
AA Change: D23G
SMART Domains Protein: ENSMUSP00000140807
Gene: ENSMUSG00000026414
AA Change: D23G

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 201 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190451
SMART Domains Protein: ENSMUSP00000140282
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
PDB:2Z5H|T 85 114 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191055
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during and prior to organogenesis and abnormal heart development. Mice homozygous for an allele that lacks the lysine residue at position 210 exhibit dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Tnnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tnnt2 APN 1 135851702 missense probably damaging 1.00
IGL00885:Tnnt2 APN 1 135846764 splice site probably benign
IGL02223:Tnnt2 APN 1 135842015 intron probably benign
IGL03094:Tnnt2 APN 1 135849462 critical splice donor site probably null
R0827:Tnnt2 UTSW 1 135843796 intron probably benign
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1478:Tnnt2 UTSW 1 135848026 missense probably benign 0.40
R1728:Tnnt2 UTSW 1 135845506 intron probably benign
R1729:Tnnt2 UTSW 1 135845506 intron probably benign
R1730:Tnnt2 UTSW 1 135845506 intron probably benign
R1739:Tnnt2 UTSW 1 135845506 intron probably benign
R1762:Tnnt2 UTSW 1 135845506 intron probably benign
R1783:Tnnt2 UTSW 1 135845506 intron probably benign
R1784:Tnnt2 UTSW 1 135845506 intron probably benign
R1785:Tnnt2 UTSW 1 135845506 intron probably benign
R1891:Tnnt2 UTSW 1 135840859 critical splice acceptor site probably null
R2049:Tnnt2 UTSW 1 135846761 splice site probably benign
R2104:Tnnt2 UTSW 1 135843809 intron probably benign
R2130:Tnnt2 UTSW 1 135846761 splice site probably benign
R2141:Tnnt2 UTSW 1 135846761 splice site probably benign
R2227:Tnnt2 UTSW 1 135843791 intron probably benign
R2504:Tnnt2 UTSW 1 135852065 missense probably damaging 0.96
R4883:Tnnt2 UTSW 1 135847758 nonsense probably null
R5963:Tnnt2 UTSW 1 135843862 intron probably benign
R6082:Tnnt2 UTSW 1 135849434 missense probably benign 0.30
R6261:Tnnt2 UTSW 1 135850554 intron probably null
Predicted Primers PCR Primer
(F):5'- GAGTGAGGCTGCCATATTGC -3'
(R):5'- TCACAGGAATCCTTCTGTGAC -3'

Sequencing Primer
(F):5'- CTGCCATATTGCTTGAATGTTGAC -3'
(R):5'- CACAGGAATCCTTCTGTGACCATATG -3'
Posted On2014-10-15