Mutagenetix > Incidental Mutations

Incidental Mutation 'R2225:Rpgrip1l'

239673

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

040226-MU

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91221467 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1196 (E1196G)

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]

Predicted Effect

probably benign
Transcript: ENSMUST00000047783
AA Change: E1196G

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: E1196G

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211546

Meta Mutation Damage Score

0.11

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	C	6: 88,836,367	L439R	probably damaging	Het
Adcy10	A	G	1: 165,518,260	T293A	probably damaging	Het
Aen	C	A	7: 78,902,451	T15K	probably benign	Het
Aggf1	A	G	13: 95,370,846	S144P	probably damaging	Het
Akap9	A	T	5: 4,077,271	R3706S	probably damaging	Het
Btd	A	G	14: 31,667,060	D246G	probably benign	Het
Ccdc33	A	G	9: 58,082,022	S123P	probably damaging	Het
Cep152	T	C	2: 125,581,784	E899G	probably damaging	Het
Cpsf6	A	T	10: 117,363,036		probably benign	Het
Crybg3	A	G	16: 59,554,678	I2071T	probably damaging	Het
Cwc22	T	A	2: 77,908,151		probably benign	Het
Ddah2	T	A	17: 35,060,211	I16N	probably damaging	Het
Dld	T	G	12: 31,341,449	M123L	probably benign	Het
Eif5b	A	T	1: 38,019,223	K202I	unknown	Het
Gm6430	T	C	1: 97,025,716		noncoding transcript	Het
Hdac9	C	T	12: 34,407,802	V251I	probably benign	Het
Hoxa10	T	C	6: 52,232,636	E52G	probably damaging	Het
Hspa4	C	T	11: 53,286,933	V117M	probably benign	Het
Htra4	T	C	8: 25,025,720	D434G	probably benign	Het
Itgb3	A	G	11: 104,665,510	M726V	probably benign	Het
Itih1	A	G	14: 30,929,577	V886A	possibly damaging	Het
Kdm1b	TCATTGTCC	TCATTGTCCATTGTCC	13: 47,064,088		probably null	Het
Kpna1	G	A	16: 36,031,221	A392T	probably damaging	Het
Limk1	G	T	5: 134,661,556		probably null	Het
Lonrf1	T	C	8: 36,236,098	D308G	probably damaging	Het
Muc4	A	T	16: 32,755,891		probably benign	Het
Muc4	G	A	16: 32,766,942	C2719Y	possibly damaging	Het
Mvb12b	G	A	2: 33,840,199	T60I	possibly damaging	Het
Myh2	C	T	11: 67,193,729	T1698M	probably benign	Het
Naalad2	A	T	9: 18,376,533	V267E	possibly damaging	Het
Nkpd1	A	T	7: 19,519,820	Y37F	probably benign	Het
Olfr167	T	C	16: 19,515,246	H130R	probably benign	Het
Olfr952	T	C	9: 39,426,619	I151V	probably benign	Het
Olfr975	T	C	9: 39,950,537	K78R	possibly damaging	Het
Plekhg2	G	A	7: 28,360,335	P1190S	probably benign	Het
Reck	A	G	4: 43,922,837	T371A	probably benign	Het
Rnf185	T	C	11: 3,432,445	D44G	probably damaging	Het
Rundc1	A	G	11: 101,431,344		probably benign	Het
Sf3b3	T	C	8: 110,814,573	Y970C	probably damaging	Het
Sfxn1	A	G	13: 54,085,517	T20A	possibly damaging	Het
Shprh	T	C	10: 11,162,235		probably benign	Het
Spata31d1a	T	A	13: 59,703,715	I200L	probably benign	Het
Srsf6	G	A	2: 162,931,699	S10N	probably damaging	Het
Tbxa2r	A	G	10: 81,333,149	Y224C	probably benign	Het
Tlr5	A	G	1: 182,972,376		probably benign	Het
Tmem270	A	G	5: 134,906,638	L21P	probably damaging	Het
Tmtc2	T	C	10: 105,370,357	E359G	probably benign	Het
Tnn	A	T	1: 160,147,465	C131S	probably damaging	Het
Tnnt2	A	G	1: 135,843,791		probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tph1	A	G	7: 46,665,174		probably null	Het
Wiz	C	T	17: 32,356,925	V836M	probably damaging	Het
Zfp451	T	A	1: 33,770,907		probably benign	Het
Zfp738	A	G	13: 67,670,312	F520S	probably damaging	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	probably damaging	0.99
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R1915:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4802:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4921:Rpgrip1l	UTSW	8	91261009	missense	probably benign	0.05
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5092:Rpgrip1l	UTSW	8	91221384	nonsense	probably null
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5119:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CCTTCTGCTGAGGTGTAACAGAC -3'
(R):5'- GGGGAGCTCCAAGGTTCTAATAG -3'

Sequencing Primer
(F):5'- TGAGGTGTAACAGACCCTCCTAG -3'
(R):5'- TGCTCCATGGTAGTGATC -3'

Posted On

2014-10-15