Mutagenetix > Incidental Mutations

Incidental Mutation 'R0184:Itgam'

23968

Institutional Source

Beutler Lab

Gene Symbol

Itgam

Ensembl Gene

ENSMUSG00000030786

Gene Name

integrin alpha M

Synonyms

Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3

MMRRC Submission

038449-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.384) question?

Stock #

R0184 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

128062640-128118491 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128086058 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 448 (I448F)

Ref Sequence

ENSEMBL: ENSMUSP00000113957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]

Predicted Effect

probably benign
Transcript: ENSMUST00000064821
AA Change: I448F

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: I448F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
Pfam:Integrin_alpha	1130	1144	2.1e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098015
AA Change: I448F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: I448F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106240
AA Change: I448F

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: I448F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	462	516	3.67e-3	SMART
low complexity region	732	738	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106242
AA Change: I448F

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: I448F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
Pfam:Integrin_alpha	1131	1145	8.4e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120355
AA Change: I448F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: I448F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
low complexity region	1141	1150	N/A	INTRINSIC

Meta Mutation Damage Score

0.02

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.9%

Validation Efficiency

66% (50/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	A	3: 124,419,250	V131F	probably damaging	Het
Adam28	T	C	14: 68,637,373	D285G	probably benign	Het
Akr1c13	A	G	13: 4,194,056	E36G	probably damaging	Het
Antxr2	A	G	5: 97,980,030	L214S	probably damaging	Het
Arhgap26	T	A	18: 38,617,673	D46E	unknown	Het
Armc9	T	C	1: 86,198,370	L61P	probably damaging	Het
Bicc1	C	A	10: 71,079,215	R73L	probably benign	Het
Calm2	T	C	17: 87,435,841	N43S	probably benign	Het
Cct7	A	G	6: 85,461,554	D105G	probably null	Het
Cdk18	T	C	1: 132,118,538	N215D	probably benign	Het
Cep126	T	C	9: 8,103,395	T205A	probably benign	Het
Cfap57	A	T	4: 118,599,012	I495N	probably damaging	Het
Cyp2b9	T	A	7: 26,187,007	C152*	probably null	Het
Dab2ip	G	A	2: 35,718,791	R579H	probably damaging	Het
Dnah8	T	C	17: 30,683,683	V905A	probably benign	Het
Eif4h	C	A	5: 134,625,375	D134Y	possibly damaging	Het
Espl1	T	A	15: 102,299,216	S372T	probably benign	Het
Fat2	T	A	11: 55,296,288	H1244L	probably damaging	Het
Fbxo11	T	A	17: 88,008,673	N443I	probably benign	Het
Git2	G	A	5: 114,739,037	T128M	possibly damaging	Het
Gm10985	T	A	3: 53,845,258	Y21N	probably damaging	Het
Gm12790	A	T	4: 101,967,614	Y152*	probably null	Het
Heatr5a	T	C	12: 51,909,969	D1115G	probably benign	Het
Hipk2	T	C	6: 38,718,931	N726S	possibly damaging	Het
Hrg	T	C	16: 22,953,771		probably null	Het
Iars	T	G	13: 49,722,212	S792A	probably benign	Het
Igf1r	A	G	7: 68,226,193	N1301S	possibly damaging	Het
Il22	A	T	10: 118,205,606	I75F	probably damaging	Het
Ilkap	T	C	1: 91,376,305		probably benign	Het
Ints13	A	T	6: 146,555,044	Y435N	probably benign	Het
Ints8	A	C	4: 11,218,637	S797A	probably benign	Het
Itgad	T	A	7: 128,189,231	D405E	probably benign	Het
Klk1	C	T	7: 44,228,749	T41I	possibly damaging	Het
Mcrip1	T	C	11: 120,544,884	M1V	probably null	Het
Mdga1	A	G	17: 29,852,442	Y128H	probably damaging	Het
Mtor	G	T	4: 148,464,971	R604L	probably benign	Het
Olfr1170	A	T	2: 88,224,780	L84*	probably null	Het
Olfr656	T	C	7: 104,618,240	V187A	probably damaging	Het
Pcdhb7	T	A	18: 37,343,390	D526E	probably benign	Het
Pip4k2a	T	C	2: 18,889,128	D139G	probably damaging	Het
Pkp3	A	C	7: 141,088,367	N536T	probably benign	Het
Pla2g4c	T	A	7: 13,356,220	S524T	probably benign	Het
Pno1	T	C	11: 17,211,127	E69G	probably benign	Het
Pold1	C	T	7: 44,541,715	V231M	probably benign	Het
Poli	A	G	18: 70,522,731	S248P	probably damaging	Het
Ppox	C	T	1: 171,279,552	S138N	probably damaging	Het
Psg20	T	C	7: 18,685,976	E6G	probably null	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Rln1	T	A	19: 29,331,936	K148*	probably null	Het
Rnf213	C	T	11: 119,414,521	T526I	probably damaging	Het
Rps6kc1	A	T	1: 190,799,093	V904E	probably null	Het
Sf3b2	T	A	19: 5,283,672	I633F	probably damaging	Het
Sfswap	T	A	5: 129,507,189	I189N	probably damaging	Het
Smarca2	T	A	19: 26,692,249	Y973*	probably null	Het
Spink5	G	A	18: 44,003,198	D559N	probably benign	Het
Spty2d1	C	T	7: 46,997,574	V536I	possibly damaging	Het
Tbx3	T	C	5: 119,675,562	I221T	probably damaging	Het
Tcf20	T	A	15: 82,852,300	D1650V	probably damaging	Het
Thsd7b	A	G	1: 129,430,964	K45R	probably benign	Het
Tirap	A	G	9: 35,189,194	S65P	probably benign	Het
Trim25	C	T	11: 88,999,640	P51L	probably damaging	Het
Trim61	T	C	8: 65,014,417	N64S	probably benign	Het
Twf1	T	A	15: 94,581,067		probably null	Het
Ubr4	A	C	4: 139,445,262	T1692P	probably damaging	Het
Usp3	A	G	9: 66,562,581	M86T	probably damaging	Het
Utrn	T	C	10: 12,667,618	D1762G	probably benign	Het
V1rd19	T	A	7: 24,003,207	F33I	probably benign	Het
Vmn2r52	T	C	7: 10,159,338	S625G	probably damaging	Het
Vmn2r90	G	A	17: 17,726,877	W472*	probably null	Het
Vrk2	C	A	11: 26,550,046	A56S	probably damaging	Het
Yeats2	C	T	16: 20,203,685	P620S	possibly damaging	Het
Zbtb21	C	T	16: 97,950,513	D171N	probably damaging	Het
Zeb1	A	T	18: 5,766,808	I440F	probably damaging	Het
Zfp292	A	G	4: 34,819,563	I253T	probably damaging	Het

Other mutations in Itgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Itgam	APN	7	128085661	missense	probably damaging	1.00
IGL00983:Itgam	APN	7	128068667	missense	probably damaging	0.97
IGL01102:Itgam	APN	7	128080273	missense	possibly damaging	0.94
IGL01615:Itgam	APN	7	128116767	missense	possibly damaging	0.80
IGL01845:Itgam	APN	7	128112472	missense	probably damaging	1.00
IGL01860:Itgam	APN	7	128070943	missense	probably benign	0.03
IGL01874:Itgam	APN	7	128115166	missense	probably damaging	0.97
IGL01910:Itgam	APN	7	128083776	missense	probably damaging	1.00
IGL01994:Itgam	APN	7	128101727	missense	probably damaging	0.97
IGL02332:Itgam	APN	7	128085674	critical splice donor site	probably null
IGL02348:Itgam	APN	7	128116300	missense	possibly damaging	0.52
IGL02394:Itgam	APN	7	128084942	missense	probably benign	0.01
IGL02491:Itgam	APN	7	128116018	missense	possibly damaging	0.71
IGL02695:Itgam	APN	7	128085941	missense	possibly damaging	0.81
IGL02821:Itgam	APN	7	128076109	missense	probably damaging	0.99
IGL02970:Itgam	APN	7	128086043	missense	probably benign	0.00
IGL03145:Itgam	APN	7	128113019	missense	probably benign	0.12
apparition	UTSW	7	128112286	splice site	probably null
invisible	UTSW	7	128070703	unclassified	probably null
obscured	UTSW	7	128081634	missense	probably damaging	1.00
R0389:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0443:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0454:Itgam	UTSW	7	128107980	missense	probably benign	0.01
R0674:Itgam	UTSW	7	128116218	missense	possibly damaging	0.67
R0828:Itgam	UTSW	7	128116505	critical splice donor site	probably null
R0925:Itgam	UTSW	7	128112238	missense	probably benign	0.00
R1086:Itgam	UTSW	7	128080264	missense	probably damaging	1.00
R1655:Itgam	UTSW	7	128115163	missense	probably benign	0.00
R1809:Itgam	UTSW	7	128070937	missense	possibly damaging	0.62
R1823:Itgam	UTSW	7	128064732	missense	probably benign	0.04
R2105:Itgam	UTSW	7	128081712	missense	probably damaging	1.00
R2154:Itgam	UTSW	7	128085577	missense	probably damaging	0.99
R2656:Itgam	UTSW	7	128116815	missense	probably null	1.00
R2913:Itgam	UTSW	7	128112406	missense	probably damaging	1.00
R3116:Itgam	UTSW	7	128116029	missense	probably damaging	1.00
R3404:Itgam	UTSW	7	128070703	unclassified	probably null
R3821:Itgam	UTSW	7	128112286	splice site	probably null
R3822:Itgam	UTSW	7	128112286	splice site	probably null
R3960:Itgam	UTSW	7	128115175	missense	probably benign	0.02
R3968:Itgam	UTSW	7	128113033	missense	probably damaging	1.00
R4192:Itgam	UTSW	7	128064732	missense	probably benign	0.21
R4400:Itgam	UTSW	7	128081658	missense	probably damaging	1.00
R4708:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4709:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4742:Itgam	UTSW	7	128113073	missense	probably damaging	1.00
R4790:Itgam	UTSW	7	128116273	missense	probably benign	0.01
R4960:Itgam	UTSW	7	128115840	missense	possibly damaging	0.93
R5109:Itgam	UTSW	7	128113218	missense	probably benign	0.06
R5190:Itgam	UTSW	7	128116317	unclassified	probably null
R5379:Itgam	UTSW	7	128112388	missense	probably damaging	1.00
R5386:Itgam	UTSW	7	128107980	missense	probably benign	0.00
R6104:Itgam	UTSW	7	128116302	missense	possibly damaging	0.85
R6122:Itgam	UTSW	7	128085652	missense	probably damaging	0.99
R6189:Itgam	UTSW	7	128112504	missense	probably benign	0.04
R6282:Itgam	UTSW	7	128084942	missense	probably benign	0.01
R6545:Itgam	UTSW	7	128107872	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCCTACTGTGGAAAGGAGGAC -3'
(R):5'- TCACTGCTGGAAATGCTGAGGC -3'

Sequencing Primer
(F):5'- CTTGAGGAACCGTGTCCAAA -3'
(R):5'- ccaaaccccagaaccacag -3'

Posted On

2013-04-16