Incidental Mutation 'R2225:Rnf185'
ID239683
Institutional Source Beutler Lab
Gene Symbol Rnf185
Ensembl Gene ENSMUSG00000020448
Gene Namering finger protein 185
Synonyms
MMRRC Submission 040226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R2225 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3415982-3452363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3432445 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000076333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064364] [ENSMUST00000077078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064364
AA Change: D80G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067053
Gene: ENSMUSG00000020448
AA Change: D80G

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
RING 75 115 9.23e-9 SMART
low complexity region 143 154 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 209 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077078
AA Change: D44G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076333
Gene: ENSMUSG00000020448
AA Change: D44G

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
RING 39 79 9.23e-9 SMART
low complexity region 107 118 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
transmembrane domain 173 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144055
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I357T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Rnf185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Rnf185 APN 11 3418015 missense possibly damaging 0.79
R0026:Rnf185 UTSW 11 3426617 missense probably damaging 0.99
R2111:Rnf185 UTSW 11 3432393 splice site probably benign
R2508:Rnf185 UTSW 11 3418067 missense probably benign 0.00
R3907:Rnf185 UTSW 11 3426681 splice site probably benign
R4767:Rnf185 UTSW 11 3432551 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGGTCTGAGAGCATCAAGAATC -3'
(R):5'- TAGGCTGCAGCAATGGACAATC -3'

Sequencing Primer
(F):5'- GAATCAAAATGAGTGAGACATCTACC -3'
(R):5'- GGACAATCAAGTGCTTTCTGC -3'
Posted On2014-10-15