Incidental Mutation 'R0184:Iars'
ID23991
Institutional Source Beutler Lab
Gene Symbol Iars
Ensembl Gene ENSMUSG00000037851
Gene Nameisoleucine-tRNA synthetase
SynonymsE430001P04Rik, 2510016L12Rik
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0184 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location49682100-49734267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49722212 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 792 (S792A)
Ref Sequence ENSEMBL: ENSMUSP00000132082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316]
Predicted Effect probably benign
Transcript: ENSMUST00000047363
AA Change: S792A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: S792A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 9.2e-242 PFAM
Pfam:tRNA-synt_1g 46 197 3.7e-6 PFAM
Pfam:Anticodon_1 693 852 1.1e-23 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164260
AA Change: S792A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: S792A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165270
Predicted Effect probably benign
Transcript: ENSMUST00000165316
AA Change: S792A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: S792A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 17 639 5.5e-238 PFAM
Pfam:tRNA-synt_1g 46 205 5.2e-8 PFAM
Pfam:tRNA-synt_1g 521 659 2.1e-5 PFAM
Pfam:Anticodon_1 693 852 7.1e-24 PFAM
low complexity region 1159 1167 N/A INTRINSIC
low complexity region 1169 1180 N/A INTRINSIC
low complexity region 1220 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165656
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Iars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Iars APN 13 49709728 missense probably damaging 1.00
IGL00764:Iars APN 13 49711827 missense probably benign 0.34
IGL01153:Iars APN 13 49711805 missense probably damaging 1.00
IGL01481:Iars APN 13 49728698 missense probably benign 0.00
IGL01596:Iars APN 13 49703176 missense probably benign
IGL01682:Iars APN 13 49709658 missense probably damaging 1.00
IGL01885:Iars APN 13 49691499 missense probably benign 0.25
IGL01907:Iars APN 13 49709655 missense probably damaging 1.00
IGL02023:Iars APN 13 49688249 missense probably damaging 1.00
IGL02121:Iars APN 13 49724696 missense probably benign 0.00
IGL02365:Iars APN 13 49691499 missense probably benign 0.25
IGL02704:Iars APN 13 49721100 missense probably damaging 1.00
IGL02838:Iars APN 13 49690489 missense possibly damaging 0.87
IGL02975:Iars APN 13 49704849 missense probably damaging 1.00
IGL02982:Iars APN 13 49709709 missense probably benign 0.00
IGL03034:Iars APN 13 49690489 missense possibly damaging 0.87
IGL03060:Iars APN 13 49690447 critical splice acceptor site probably null
IGL03156:Iars APN 13 49703179 missense possibly damaging 0.87
IGL03206:Iars APN 13 49693070 missense possibly damaging 0.81
IGL03343:Iars APN 13 49724747 missense probably benign 0.12
gannett_peak UTSW 13 49708421 missense probably damaging 1.00
wind_river UTSW 13 49701895 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0054:Iars UTSW 13 49693135 missense probably damaging 1.00
R0200:Iars UTSW 13 49726202 missense possibly damaging 0.62
R0356:Iars UTSW 13 49703233 missense probably benign 0.03
R0383:Iars UTSW 13 49732342 missense probably damaging 0.99
R0657:Iars UTSW 13 49702519 missense probably damaging 1.00
R1005:Iars UTSW 13 49687445 missense possibly damaging 0.94
R1427:Iars UTSW 13 49704269 critical splice acceptor site probably null
R1449:Iars UTSW 13 49733710 missense probably damaging 0.99
R1647:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1648:Iars UTSW 13 49723002 missense possibly damaging 0.85
R1664:Iars UTSW 13 49711775 missense probably damaging 0.98
R1763:Iars UTSW 13 49723077 critical splice donor site probably null
R2192:Iars UTSW 13 49688129 intron probably null
R2203:Iars UTSW 13 49722675 missense probably benign 0.00
R2357:Iars UTSW 13 49688203 missense probably damaging 1.00
R3724:Iars UTSW 13 49687384 critical splice acceptor site probably null
R4785:Iars UTSW 13 49724663 missense probably damaging 0.99
R4934:Iars UTSW 13 49717984 missense probably benign 0.17
R4999:Iars UTSW 13 49709661 missense probably damaging 1.00
R5048:Iars UTSW 13 49688237 missense probably damaging 0.99
R5268:Iars UTSW 13 49690491 missense probably damaging 1.00
R5394:Iars UTSW 13 49722165 missense probably damaging 1.00
R5486:Iars UTSW 13 49709573 splice site probably null
R5960:Iars UTSW 13 49724637 missense possibly damaging 0.68
R5972:Iars UTSW 13 49709632 missense possibly damaging 0.91
R5978:Iars UTSW 13 49722993 missense probably damaging 0.99
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6031:Iars UTSW 13 49705831 missense probably damaging 0.98
R6092:Iars UTSW 13 49708421 missense probably damaging 1.00
R6167:Iars UTSW 13 49722714 missense probably damaging 1.00
R6313:Iars UTSW 13 49708445 missense probably damaging 0.99
R6358:Iars UTSW 13 49727143 missense possibly damaging 0.67
R6385:Iars UTSW 13 49701895 missense probably damaging 1.00
R6403:Iars UTSW 13 49687495 missense probably damaging 1.00
R6575:Iars UTSW 13 49725269 missense probably damaging 1.00
R6675:Iars UTSW 13 49719578 missense probably damaging 0.99
R6957:Iars UTSW 13 49722161 missense probably damaging 1.00
Z1088:Iars UTSW 13 49721088 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTATGCCTGTCTGTGTATTGC -3'
(R):5'- AAGGAGGATGCTATACCCCTGCTAC -3'

Sequencing Primer
(F):5'- GCTATTCTCCTCTCTAAAGTGACTGG -3'
(R):5'- TGCAGCCTGAGGAGTAGC -3'
Posted On2013-04-16