Incidental Mutation 'R2234:Akap8l'
ID239953
Institutional Source Beutler Lab
Gene Symbol Akap8l
Ensembl Gene ENSMUSG00000002625
Gene NameA kinase (PRKA) anchor protein 8-like
SynonymsNakap95
MMRRC Submission 040235-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R2234 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32321425-32350581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32338803 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 37 (G37R)
Ref Sequence ENSEMBL: ENSMUSP00000051389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050214]
Predicted Effect probably damaging
Transcript: ENSMUST00000050214
AA Change: G37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: G37R

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chfr A G 5: 110,170,863 K580E probably damaging Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1089 A G 2: 86,733,577 F12L possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in Akap8l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Akap8l APN 17 32333097 missense possibly damaging 0.82
IGL01603:Akap8l APN 17 32345353 missense probably damaging 1.00
IGL02028:Akap8l APN 17 32338521 splice site probably null
IGL02033:Akap8l APN 17 32338272 missense probably damaging 1.00
IGL02301:Akap8l APN 17 32332926 splice site probably benign
R1136:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1137:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1192:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1277:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1279:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1703:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1705:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1706:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1727:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1763:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1774:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1796:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1954:Akap8l UTSW 17 32336736 missense possibly damaging 0.74
R2072:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2073:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2074:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2107:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2108:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2214:Akap8l UTSW 17 32338825 critical splice acceptor site probably null
R2215:Akap8l UTSW 17 32321595 missense possibly damaging 0.72
R2219:Akap8l UTSW 17 32334631 missense probably benign 0.23
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R4273:Akap8l UTSW 17 32321931 nonsense probably null
R4379:Akap8l UTSW 17 32321514 unclassified probably benign
R5061:Akap8l UTSW 17 32332894 missense probably damaging 1.00
R5337:Akap8l UTSW 17 32336394 missense possibly damaging 0.71
R5377:Akap8l UTSW 17 32321511 unclassified probably benign
R5579:Akap8l UTSW 17 32321942 missense probably damaging 1.00
R5609:Akap8l UTSW 17 32338400 missense probably damaging 1.00
R5667:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5671:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5747:Akap8l UTSW 17 32345378 missense probably damaging 0.97
R6186:Akap8l UTSW 17 32333044 missense probably benign 0.02
R6400:Akap8l UTSW 17 32336320 missense probably damaging 0.99
R6482:Akap8l UTSW 17 32345396 missense possibly damaging 0.94
R6712:Akap8l UTSW 17 32332888 missense probably damaging 1.00
V5088:Akap8l UTSW 17 32336739 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCGTAGCCTGCAGTTAGG -3'
(R):5'- CCAGGTGCTTGTGTAGAGTC -3'

Sequencing Primer
(F):5'- TAAGCTGGGGGAACTCTTAGCC -3'
(R):5'- GTCCAGTGTATAGTACCTTGGAAAG -3'
Posted On2014-10-15