Incidental Mutation 'R2230:Myo5c'
ID239999
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 040231-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2230 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75273606 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 759 (D759G)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: D759G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: D759G

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Meta Mutation Damage Score 0.1632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam12 A T 7: 133,919,618 N280K probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Apoa2 A G 1: 171,225,771 K53R probably benign Het
Atr A G 9: 95,920,765 R1827G probably damaging Het
Ccdc61 T C 7: 18,891,107 E502G probably damaging Het
Cdon T C 9: 35,491,926 probably null Het
Ctgf T A 10: 24,596,473 M138K possibly damaging Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dock2 T A 11: 34,294,323 I1036F probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
F2 T C 2: 91,625,757 D553G probably benign Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Gm10650 A G 3: 128,039,763 noncoding transcript Het
Gm21850 G T 2: 154,058,328 V202L probably benign Het
Hdc T A 2: 126,594,018 E644D possibly damaging Het
Hypk G A 2: 121,457,292 probably null Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
Mgll G A 6: 88,825,732 V318M possibly damaging Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Musk A T 4: 58,333,672 I256F possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nkx2-1 G A 12: 56,533,286 Q290* probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Olfr828 A G 9: 18,815,725 S190P probably damaging Het
Olfr891 T C 9: 38,180,146 T226A probably benign Het
Pabpc2 G A 18: 39,775,070 V463I probably benign Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plxnd1 C A 6: 115,964,144 R1302L probably damaging Het
Pnpla7 T C 2: 25,051,598 probably benign Het
Ppl G A 16: 5,088,981 T1150I possibly damaging Het
Prkag2 G T 5: 24,908,364 A113E probably benign Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sec14l5 A G 16: 5,176,481 T380A probably damaging Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Sspo C A 6: 48,500,503 Q5123K probably benign Het
Tbc1d21 A C 9: 58,363,080 N137K probably damaging Het
Tek G A 4: 94,811,336 C317Y probably damaging Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Topbp1 T A 9: 103,345,848 I1377N probably damaging Het
Ttf2 A G 3: 100,957,944 V544A probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Ugt2b38 A G 5: 87,421,668 F267L probably benign Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Vwa8 T C 14: 79,092,403 probably null Het
Zfp708 A T 13: 67,070,972 Y229* probably null Het
Zzef1 T A 11: 72,884,416 M1745K probably damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAGCTATGATGCCCAG -3'
(R):5'- TTGTTGACCTGGGAAGTCAC -3'

Sequencing Primer
(F):5'- GCCTTGTGCATATGTAATACCAATG -3'
(R):5'- CCTGGGAAGTCACTGGTGTAAC -3'
Posted On2014-10-15