Incidental Mutation 'R2230:Ctgf'
ID240003
Institutional Source Beutler Lab
Gene Symbol Ctgf
Ensembl Gene ENSMUSG00000019997
Gene Nameconnective tissue growth factor
SynonymsHcs24, Ccn2, Fisp12, hypertrophic chondrocyte-specific gene product 24
MMRRC Submission 040231-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2230 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24595442-24598683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24596473 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 138 (M138K)
Ref Sequence ENSEMBL: ENSMUSP00000135147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020171] [ENSMUST00000129142] [ENSMUST00000176228]
Predicted Effect probably benign
Transcript: ENSMUST00000020171
AA Change: M138K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020171
Gene: ENSMUSG00000019997
AA Change: M138K

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
CT 260 329 1.17e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125158
Predicted Effect probably benign
Transcript: ENSMUST00000129142
SMART Domains Protein: ENSMUSP00000135212
Gene: ENSMUSG00000019997

DomainStartEndE-ValueType
IB 3 73 1.45e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141076
Predicted Effect possibly damaging
Transcript: ENSMUST00000176228
AA Change: M138K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135147
Gene: ENSMUSG00000019997
AA Change: M138K

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die at birth from respiratory failure due to axial skeletal defects and pulmonary hypoplasia associated with reduced cell proliferation, enhanced apoptosis and altered pneumocyte maturation. Osteogenesis is impaired due to impaired chondrogenesis and growth plate angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam12 A T 7: 133,919,618 N280K probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Apoa2 A G 1: 171,225,771 K53R probably benign Het
Atr A G 9: 95,920,765 R1827G probably damaging Het
Ccdc61 T C 7: 18,891,107 E502G probably damaging Het
Cdon T C 9: 35,491,926 probably null Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dock2 T A 11: 34,294,323 I1036F probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
F2 T C 2: 91,625,757 D553G probably benign Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Gm10650 A G 3: 128,039,763 noncoding transcript Het
Gm21850 G T 2: 154,058,328 V202L probably benign Het
Hdc T A 2: 126,594,018 E644D possibly damaging Het
Hypk G A 2: 121,457,292 probably null Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
Mgll G A 6: 88,825,732 V318M possibly damaging Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Musk A T 4: 58,333,672 I256F possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Myo5c A G 9: 75,273,606 D759G probably benign Het
Nkx2-1 G A 12: 56,533,286 Q290* probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Olfr828 A G 9: 18,815,725 S190P probably damaging Het
Olfr891 T C 9: 38,180,146 T226A probably benign Het
Pabpc2 G A 18: 39,775,070 V463I probably benign Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plxnd1 C A 6: 115,964,144 R1302L probably damaging Het
Pnpla7 T C 2: 25,051,598 probably benign Het
Ppl G A 16: 5,088,981 T1150I possibly damaging Het
Prkag2 G T 5: 24,908,364 A113E probably benign Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sec14l5 A G 16: 5,176,481 T380A probably damaging Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Sspo C A 6: 48,500,503 Q5123K probably benign Het
Tbc1d21 A C 9: 58,363,080 N137K probably damaging Het
Tek G A 4: 94,811,336 C317Y probably damaging Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Topbp1 T A 9: 103,345,848 I1377N probably damaging Het
Ttf2 A G 3: 100,957,944 V544A probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Ugt2b38 A G 5: 87,421,668 F267L probably benign Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Vwa5a G A 9: 38,733,878 G420R probably null Het
Vwa8 T C 14: 79,092,403 probably null Het
Zfp708 A T 13: 67,070,972 Y229* probably null Het
Zzef1 T A 11: 72,884,416 M1745K probably damaging Het
Other mutations in Ctgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ctgf APN 10 24596409 missense probably damaging 1.00
IGL02994:Ctgf APN 10 24596865 missense probably damaging 1.00
PIT4131001:Ctgf UTSW 10 24596090 missense probably damaging 0.97
R0443:Ctgf UTSW 10 24595803 splice site probably benign
R0496:Ctgf UTSW 10 24597515 missense possibly damaging 0.51
R0538:Ctgf UTSW 10 24596466 missense probably damaging 1.00
R1599:Ctgf UTSW 10 24597399 missense probably benign 0.08
R1721:Ctgf UTSW 10 24596797 missense probably damaging 1.00
R2095:Ctgf UTSW 10 24596479 missense probably benign 0.41
R2322:Ctgf UTSW 10 24596834 missense probably damaging 1.00
R4913:Ctgf UTSW 10 24597327 missense probably damaging 1.00
R5697:Ctgf UTSW 10 24597456 missense probably benign
R6705:Ctgf UTSW 10 24595955 missense probably damaging 0.99
R7067:Ctgf UTSW 10 24596975 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TAGCTGTTCTGATCCCTGTGAC -3'
(R):5'- ACAATTTCCCCTTAATTTGGTGGAC -3'

Sequencing Primer
(F):5'- TGTGACCCTACGCCTGAC -3'
(R):5'- GCATTGGCCCTGAAGTTGG -3'
Posted On2014-10-15