Incidental Mutation 'R2231:Spag1'
ID240055
Institutional Source Beutler Lab
Gene Symbol Spag1
Ensembl Gene ENSMUSG00000037617
Gene Namesperm associated antigen 1
Synonymstpis, TPR-containing protein involved in spermatogenesis
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location36178099-36235621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36191167 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 180 (Y180C)
Ref Sequence ENSEMBL: ENSMUSP00000132233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047348] [ENSMUST00000171205]
Predicted Effect probably benign
Transcript: ENSMUST00000047348
AA Change: Y180C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047335
Gene: ENSMUSG00000037617
AA Change: Y180C

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171205
AA Change: Y180C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132233
Gene: ENSMUSG00000037617
AA Change: Y180C

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227524
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Arsa T C 15: 89,475,722 M1V probably null Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Coch G A 12: 51,602,865 V320I probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Eif2b5 T C 16: 20,504,770 Y424H probably benign Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1445 A G 19: 12,883,949 I23V probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Trdmt1 A T 2: 13,525,625 F82I probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Zw10 C T 9: 49,064,121 T282M possibly damaging Het
Other mutations in Spag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Spag1 APN 15 36195416 nonsense probably null
IGL00465:Spag1 APN 15 36183821 unclassified probably benign
IGL00694:Spag1 APN 15 36227171 missense possibly damaging 0.94
IGL01479:Spag1 APN 15 36233199 splice site probably benign
IGL01830:Spag1 APN 15 36221559 missense probably benign 0.01
IGL02072:Spag1 APN 15 36190512 missense probably damaging 1.00
IGL02232:Spag1 APN 15 36221564 missense probably benign 0.00
IGL02727:Spag1 APN 15 36234818 missense probably damaging 1.00
IGL02810:Spag1 APN 15 36234547 missense probably damaging 1.00
IGL03010:Spag1 APN 15 36233273 missense probably benign 0.15
IGL03069:Spag1 APN 15 36224099 splice site probably benign
IGL03244:Spag1 APN 15 36234383 missense probably benign 0.00
FR4737:Spag1 UTSW 15 36197733 critical splice acceptor site probably benign
R0863:Spag1 UTSW 15 36192047 missense probably damaging 1.00
R1177:Spag1 UTSW 15 36234767 missense probably benign 0.21
R1878:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R1879:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R2086:Spag1 UTSW 15 36227141 missense probably damaging 0.98
R2093:Spag1 UTSW 15 36224130 missense probably damaging 1.00
R4030:Spag1 UTSW 15 36234301 missense probably damaging 0.99
R4893:Spag1 UTSW 15 36197846 critical splice donor site probably null
R5047:Spag1 UTSW 15 36195442 missense probably damaging 1.00
R5505:Spag1 UTSW 15 36234626 missense probably damaging 0.99
R5741:Spag1 UTSW 15 36183703 missense possibly damaging 0.79
R5805:Spag1 UTSW 15 36200284 missense probably damaging 1.00
R6221:Spag1 UTSW 15 36197803 missense probably benign 0.30
R6236:Spag1 UTSW 15 36211135 missense probably damaging 1.00
R6556:Spag1 UTSW 15 36195407 missense probably damaging 1.00
R6800:Spag1 UTSW 15 36197749 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGATACATCAAGGGTCTC -3'
(R):5'- GTAGTCAACTCAGTCCAAAAGC -3'

Sequencing Primer
(F):5'- CGCTCTATAGACCAGGCGATATTTG -3'
(R):5'- GTCCAAAAGCCTATAAATGTTCATGG -3'
Posted On2014-10-15