Incidental Mutation 'R2231:Arsa'
List |< first << previous [record 99 of 1308] next >> last >|
ID240058
Institutional Source Beutler Lab
Gene Symbol Arsa
Ensembl Gene ENSMUSG00000022620
Gene Namearylsulfatase A
SynonymsAs2, As-2, ASA, AS-A
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89472476-89477425 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 89475722 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000127646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165199]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136218
Predicted Effect probably null
Transcript: ENSMUST00000165199
AA Change: M1V
SMART Domains Protein: ENSMUSP00000127646
Gene: ENSMUSG00000022620
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Sulfatase 20 345 4.2e-79 PFAM
Pfam:Sulfatase_C 367 501 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168052
Predicted Effect probably benign
Transcript: ENSMUST00000168270
SMART Domains Protein: ENSMUSP00000130574
Gene: ENSMUSG00000022620

DomainStartEndE-ValueType
Pfam:Sulfatase 1 37 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168835
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mice exhibit impaired balance and spatial learning ability. Sulfatide accumulates in the white matter of the brain and a reduced myelin sheath thickness in the corpus callosum and optic nerves is seen. A low frequency of head tremor develops after 2 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Coch G A 12: 51,602,865 V320I probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Eif2b5 T C 16: 20,504,770 Y424H probably benign Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1445 A G 19: 12,883,949 I23V probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Spag1 A G 15: 36,191,167 Y180C probably benign Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Trdmt1 A T 2: 13,525,625 F82I probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Zw10 C T 9: 49,064,121 T282M possibly damaging Het
Other mutations in Arsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Arsa APN 15 89473351 missense probably benign 0.04
IGL02381:Arsa APN 15 89475537 nonsense probably null
IGL02416:Arsa APN 15 89474788 missense probably damaging 1.00
IGL02997:Arsa APN 15 89474038 missense probably damaging 0.99
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0630:Arsa UTSW 15 89474004 splice site probably benign
R1052:Arsa UTSW 15 89475177 missense probably damaging 1.00
R1079:Arsa UTSW 15 89474225 splice site probably benign
R1807:Arsa UTSW 15 89475322 missense possibly damaging 0.54
R1943:Arsa UTSW 15 89473539 missense probably damaging 1.00
R5099:Arsa UTSW 15 89475339 missense probably damaging 1.00
R5461:Arsa UTSW 15 89473275 missense probably benign
R6259:Arsa UTSW 15 89475521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACATAGAAATCTGTGAACC -3'
(R):5'- TCCGAGTTCTGACAGATTCGC -3'

Sequencing Primer
(F):5'- GTGAACCGTAGTCCACCTTCAG -3'
(R):5'- CAGATTCGCTGGAGCTTCAGAG -3'
Posted On2014-10-15