Incidental Mutation 'R2233:Dync1i2'
ID240154
Institutional Source Beutler Lab
Gene Symbol Dync1i2
Ensembl Gene ENSMUSG00000027012
Gene Namedynein cytoplasmic 1 intermediate chain 2
Synonyms3110079H08Rik, Dncic2
MMRRC Submission 040234-MU
Accession Numbers

Genbank: NM_010064; MGI: 107750

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71211706-71263303 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 71249420 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 419 (Q419*)
Ref Sequence ENSEMBL: ENSMUSP00000107772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081710] [ENSMUST00000100028] [ENSMUST00000112136] [ENSMUST00000112138] [ENSMUST00000112139] [ENSMUST00000112140] [ENSMUST00000112142] [ENSMUST00000112144]
Predicted Effect probably null
Transcript: ENSMUST00000081710
AA Change: Q393*
SMART Domains Protein: ENSMUSP00000080410
Gene: ENSMUSG00000027012
AA Change: Q393*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100028
AA Change: Q413*
SMART Domains Protein: ENSMUSP00000097605
Gene: ENSMUSG00000027012
AA Change: Q413*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112136
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000107764
Gene: ENSMUSG00000027012
AA Change: Q419*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 5e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 618 632 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112138
AA Change: Q393*
SMART Domains Protein: ENSMUSP00000107766
Gene: ENSMUSG00000027012
AA Change: Q393*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112139
AA Change: Q393*
SMART Domains Protein: ENSMUSP00000107767
Gene: ENSMUSG00000027012
AA Change: Q393*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 4.5e-21 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 592 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112140
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000107768
Gene: ENSMUSG00000027012
AA Change: Q419*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112142
AA Change: Q413*
SMART Domains Protein: ENSMUSP00000107770
Gene: ENSMUSG00000027012
AA Change: Q413*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112144
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000107772
Gene: ENSMUSG00000027012
AA Change: Q419*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 133 163 6.5e-19 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141619
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit a trend towards slight locomotor deficit. [provided by MGI curators]
Allele List at MGI

All alleles(50) : Targeted, other(2) Gene trapped(48)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Dync1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Dync1i2 APN 2 71247955 splice site probably benign
IGL01609:Dync1i2 APN 2 71247008 splice site probably benign
IGL02479:Dync1i2 APN 2 71235979 missense probably damaging 1.00
IGL02545:Dync1i2 APN 2 71262751 missense possibly damaging 0.95
3-1:Dync1i2 UTSW 2 71247828 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0437:Dync1i2 UTSW 2 71227825 critical splice acceptor site probably null
R0555:Dync1i2 UTSW 2 71214518 frame shift probably null
R0835:Dync1i2 UTSW 2 71250972 missense probably damaging 1.00
R1146:Dync1i2 UTSW 2 71227820 splice site probably benign
R1452:Dync1i2 UTSW 2 71249863 splice site probably benign
R1662:Dync1i2 UTSW 2 71250979 missense possibly damaging 0.87
R1765:Dync1i2 UTSW 2 71249415 missense probably benign
R2059:Dync1i2 UTSW 2 71249853 critical splice donor site probably null
R2145:Dync1i2 UTSW 2 71214563 splice site probably benign
R2234:Dync1i2 UTSW 2 71249420 nonsense probably null
R2235:Dync1i2 UTSW 2 71249420 nonsense probably null
R3151:Dync1i2 UTSW 2 71233716 splice site probably benign
R3916:Dync1i2 UTSW 2 71249372 missense probably damaging 1.00
R4653:Dync1i2 UTSW 2 71247855 missense probably damaging 1.00
R4720:Dync1i2 UTSW 2 71233674 missense probably damaging 1.00
R4920:Dync1i2 UTSW 2 71247324 missense probably damaging 1.00
R5574:Dync1i2 UTSW 2 71233650 missense probably benign 0.15
R5620:Dync1i2 UTSW 2 71258139 missense probably benign 0.00
R5677:Dync1i2 UTSW 2 71228623 missense probably benign 0.00
R5711:Dync1i2 UTSW 2 71250982 missense probably benign 0.31
R6730:Dync1i2 UTSW 2 71247140 missense probably benign 0.18
R6911:Dync1i2 UTSW 2 71247102 missense probably benign
R7140:Dync1i2 UTSW 2 71247939 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTGGCAGGTTAACAAACC -3'
(R):5'- GAACCAACTCCATGCTATCCTAGAG -3'

Sequencing Primer
(F):5'- GGAATTGGAATACCCGTAATTAGAC -3'
(R):5'- TACCTACCTCAGTTAAATGAAAAAGC -3'
Posted On2014-10-15