Incidental Mutation 'R2233:Sel1l2'
ID240159
Institutional Source Beutler Lab
Gene Symbol Sel1l2
Ensembl Gene ENSMUSG00000074764
Gene Namesel-1 suppressor of lin-12-like 2 (C. elegans)
SynonymsLOC228684
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location140229855-140389706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140244165 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 502 (Y502C)
Ref Sequence ENSEMBL: ENSMUSP00000113800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122367]
Predicted Effect probably damaging
Transcript: ENSMUST00000122367
AA Change: Y502C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113800
Gene: ENSMUSG00000074764
AA Change: Y502C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
SEL1 107 142 1.99e2 SMART
SEL1 143 178 3.3e1 SMART
SEL1 179 214 5.7e-1 SMART
SEL1 215 250 6.3e-3 SMART
SEL1 297 333 6.59e-6 SMART
SEL1 334 370 1.32e-5 SMART
SEL1 371 406 4.55e-9 SMART
SEL1 407 442 4.02e-10 SMART
SEL1 443 478 2.72e-7 SMART
Blast:SEL1 511 550 9e-13 BLAST
SEL1 551 586 1.01e-6 SMART
SEL1 588 623 4.55e-9 SMART
transmembrane domain 661 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Sel1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Sel1l2 APN 2 140243944 missense possibly damaging 0.95
IGL01782:Sel1l2 APN 2 140243935 missense probably damaging 1.00
IGL02238:Sel1l2 APN 2 140247939 missense probably damaging 1.00
IGL02506:Sel1l2 APN 2 140275460 missense possibly damaging 0.89
IGL02539:Sel1l2 APN 2 140230858 missense probably damaging 1.00
IGL02999:Sel1l2 APN 2 140230804 missense probably damaging 1.00
IGL03388:Sel1l2 APN 2 140263364 splice site probably benign
IGL02988:Sel1l2 UTSW 2 140248588 missense probably damaging 1.00
R0386:Sel1l2 UTSW 2 140275441 missense probably benign 0.11
R0426:Sel1l2 UTSW 2 140240912 nonsense probably null
R0549:Sel1l2 UTSW 2 140265882 missense probably damaging 0.99
R1404:Sel1l2 UTSW 2 140230059 splice site probably benign
R1502:Sel1l2 UTSW 2 140389595 missense probably damaging 0.99
R1746:Sel1l2 UTSW 2 140285237 missense probably damaging 0.98
R2187:Sel1l2 UTSW 2 140230873 missense probably damaging 1.00
R2235:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R3402:Sel1l2 UTSW 2 140241038 missense probably damaging 1.00
R4717:Sel1l2 UTSW 2 140230023 missense possibly damaging 0.89
R4724:Sel1l2 UTSW 2 140240927 missense probably damaging 0.99
R4840:Sel1l2 UTSW 2 140263470 missense probably benign 0.00
R4948:Sel1l2 UTSW 2 140244166 missense probably damaging 1.00
R6008:Sel1l2 UTSW 2 140244105 missense probably damaging 1.00
R6058:Sel1l2 UTSW 2 140240969 missense possibly damaging 0.94
R6389:Sel1l2 UTSW 2 140245354 missense probably damaging 1.00
R7031:Sel1l2 UTSW 2 140340123 missense possibly damaging 0.84
R7056:Sel1l2 UTSW 2 140245414 missense probably benign 0.13
R7074:Sel1l2 UTSW 2 140263442 missense probably damaging 1.00
X0019:Sel1l2 UTSW 2 140248615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTTCCATAGCAGAAGTG -3'
(R):5'- GAAGTCCACAGGGCAGTATG -3'

Sequencing Primer
(F):5'- GGATACAACTTCTCTTTCCCCAG -3'
(R):5'- TGTGGGATGACGCTAACTAACCTC -3'
Posted On2014-10-15