Incidental Mutation 'R2233:Tmem135'
ID240178
Institutional Source Beutler Lab
Gene Symbol Tmem135
Ensembl Gene ENSMUSG00000039428
Gene Nametransmembrane protein 135
Synonyms
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location89139714-89404222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89154074 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 297 (N297S)
Ref Sequence ENSEMBL: ENSMUSP00000114097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041968] [ENSMUST00000117852]
Predicted Effect probably damaging
Transcript: ENSMUST00000041968
AA Change: N297S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428
AA Change: N297S

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117852
AA Change: N297S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428
AA Change: N297S

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156153
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Tmem135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Tmem135 APN 7 89151438 missense probably damaging 1.00
IGL01730:Tmem135 APN 7 89148044 missense possibly damaging 0.82
IGL01933:Tmem135 APN 7 89143857 unclassified probably benign
IGL02177:Tmem135 APN 7 89338453 missense probably damaging 1.00
IGL02305:Tmem135 APN 7 89165123 critical splice donor site probably null
IGL02747:Tmem135 APN 7 89144670 missense probably damaging 0.98
IGL02801:Tmem135 APN 7 89154125 missense probably benign 0.13
IGL03353:Tmem135 APN 7 89141953 missense probably damaging 1.00
skim UTSW 7 89196127 nonsense probably null
R0631:Tmem135 UTSW 7 89143788 nonsense probably null
R0657:Tmem135 UTSW 7 89144682 missense probably damaging 0.96
R3118:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R3119:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R5094:Tmem135 UTSW 7 89143793 missense probably damaging 1.00
R5225:Tmem135 UTSW 7 89196127 nonsense probably null
R5248:Tmem135 UTSW 7 89147992 missense probably damaging 1.00
R5356:Tmem135 UTSW 7 89305515 missense probably benign 0.06
R5372:Tmem135 UTSW 7 89165174 splice site probably null
R5442:Tmem135 UTSW 7 89144664 missense probably damaging 1.00
R5789:Tmem135 UTSW 7 89196122 missense possibly damaging 0.73
R5863:Tmem135 UTSW 7 89147968 critical splice donor site probably null
R6158:Tmem135 UTSW 7 89156444 missense probably benign 0.12
R6383:Tmem135 UTSW 7 89144670 missense probably damaging 0.98
R6416:Tmem135 UTSW 7 89147794 missense probably benign
R6659:Tmem135 UTSW 7 89307163 missense probably benign 0.07
R6659:Tmem135 UTSW 7 89307164 nonsense probably null
R6731:Tmem135 UTSW 7 89243964 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACACCTTATCTAACAATGGCCATG -3'
(R):5'- ACCCTGTGGTTATTGTCAGAAG -3'

Sequencing Primer
(F):5'- CCTGGGCACATGAAGGTCAG -3'
(R):5'- GAAGGTAAAAAGATGGCTTTGTTTC -3'
Posted On2014-10-15