Incidental Mutation 'R2233:Hyou1'
ID 240183
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 040234-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44300388 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 855 (T855M)
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560]
AlphaFold Q9JKR6
Predicted Effect probably benign
Transcript: ENSMUST00000066601
AA Change: T855M

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: T855M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably benign
Transcript: ENSMUST00000160902
AA Change: T855M

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: T855M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161147
Predicted Effect probably benign
Transcript: ENSMUST00000161318
AA Change: T855M

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: T855M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,584,671 (GRCm39) I360V probably benign Het
Adarb1 A G 10: 77,153,183 (GRCm39) V322A probably damaging Het
Atad2b T G 12: 5,056,745 (GRCm39) F867C probably damaging Het
Ccdc24 T C 4: 117,727,113 (GRCm39) K79R possibly damaging Het
Cfap44 A G 16: 44,271,888 (GRCm39) I1214V probably benign Het
Chrm4 A G 2: 91,758,875 (GRCm39) S428G probably benign Het
Chrnb1 A T 11: 69,686,428 (GRCm39) I64N probably damaging Het
Crh A T 3: 19,748,096 (GRCm39) M182K probably damaging Het
Dazap1 A G 10: 80,113,433 (GRCm39) K110E possibly damaging Het
Dhx16 T C 17: 36,198,778 (GRCm39) C737R probably damaging Het
Dst A G 1: 34,313,343 (GRCm39) E6384G probably damaging Het
Dync1i2 C T 2: 71,079,764 (GRCm39) Q419* probably null Het
E2f4 T A 8: 106,025,283 (GRCm39) V121E probably damaging Het
Enah G A 1: 181,749,537 (GRCm39) P415L probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fezf1 T C 6: 23,246,002 (GRCm39) T388A probably damaging Het
Gimap6 T A 6: 48,681,418 (GRCm39) H72L possibly damaging Het
Gm11149 A G 9: 49,473,446 (GRCm39) probably benign Het
Gm12695 C T 4: 96,612,266 (GRCm39) R499Q probably damaging Het
Grhl1 A G 12: 24,658,510 (GRCm39) D385G probably damaging Het
Igf1r T A 7: 67,861,828 (GRCm39) N1129K probably damaging Het
Iglon5 T C 7: 43,130,062 (GRCm39) E34G probably damaging Het
Kcnab1 T A 3: 65,226,888 (GRCm39) V189D probably damaging Het
Kifap3 T A 1: 163,683,634 (GRCm39) D438E probably benign Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lrrc41 G A 4: 115,953,582 (GRCm39) R756Q possibly damaging Het
Lrrc49 A T 9: 60,505,440 (GRCm39) F538L possibly damaging Het
Nphp3 G A 9: 103,914,575 (GRCm39) R1052H probably benign Het
Nynrin G A 14: 56,109,524 (GRCm39) V1544I possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or6z5 T C 7: 6,477,441 (GRCm39) S111P possibly damaging Het
Or9m1 G A 2: 87,733,819 (GRCm39) S67F probably damaging Het
Osbpl6 T C 2: 76,417,113 (GRCm39) F577L probably damaging Het
Otc A G X: 10,169,606 (GRCm39) Q216R probably benign Het
Ppp1r12a A G 10: 108,034,780 (GRCm39) I108M possibly damaging Het
Prl7a1 C A 13: 27,826,402 (GRCm39) probably null Het
Prss16 T C 13: 22,193,579 (GRCm39) D72G possibly damaging Het
Qrsl1 T C 10: 43,772,092 (GRCm39) K33E probably benign Het
Rabepk A T 2: 34,685,246 (GRCm39) I58N possibly damaging Het
Ralgapa1 A T 12: 55,763,856 (GRCm39) H1403Q probably benign Het
Rhobtb3 C A 13: 76,020,484 (GRCm39) C606F possibly damaging Het
Rnf216 G A 5: 143,076,681 (GRCm39) H68Y probably benign Het
Scap T C 9: 110,210,661 (GRCm39) C998R probably damaging Het
Scgb1b27 T C 7: 33,721,249 (GRCm39) Y46H probably damaging Het
Sel1l2 T C 2: 140,086,085 (GRCm39) Y502C probably damaging Het
Sf3a2 G T 10: 80,638,663 (GRCm39) A95S probably benign Het
Sis A T 3: 72,820,527 (GRCm39) F1412L probably benign Het
Slc25a29 A T 12: 108,801,587 (GRCm39) C9S possibly damaging Het
Snap91 T C 9: 86,680,624 (GRCm39) T427A probably benign Het
St3gal6 A G 16: 58,293,897 (GRCm39) F211L probably damaging Het
Stab1 G A 14: 30,883,837 (GRCm39) S240F probably benign Het
Sun3 T A 11: 8,973,371 (GRCm39) K109* probably null Het
Syne1 T C 10: 4,991,484 (GRCm39) N8410S probably benign Het
Tbx18 G T 9: 87,606,403 (GRCm39) S247R probably damaging Het
Tenm3 T C 8: 48,729,204 (GRCm39) I1601V probably benign Het
Tmem135 T C 7: 88,803,282 (GRCm39) N297S probably damaging Het
Tnk1 C T 11: 69,746,017 (GRCm39) probably null Het
Txnl4b A G 8: 110,295,551 (GRCm39) probably benign Het
Uck1 T C 2: 32,148,315 (GRCm39) D167G probably damaging Het
Vmn2r124 A T 17: 18,269,927 (GRCm39) H61L possibly damaging Het
Xylt2 C T 11: 94,560,822 (GRCm39) V239M possibly damaging Het
Zmpste24 T C 4: 120,955,162 (GRCm39) D12G probably benign Het
Zscan25 A G 5: 145,220,502 (GRCm39) Y99C probably damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44,300,539 (GRCm39) missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44,295,978 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4393:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44,300,223 (GRCm39) critical splice donor site probably null
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6613:Hyou1 UTSW 9 44,293,795 (GRCm39) missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCTCTGGATAATCTCCTCAAC -3'
(R):5'- TCTCTGTGGCAGGAAGCTTG -3'

Sequencing Primer
(F):5'- CCAGCATTTTCCTCAAGTGAGTG -3'
(R):5'- AGCTTGGCTTGTTCGGC -3'
Posted On 2014-10-15