Incidental Mutation 'R2233:Tbx18'
ID240187
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene NameT-box18
Synonyms2810404D13Rik, 2810012F10Rik
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location87702800-87731260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87724350 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 247 (S247R)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
Predicted Effect probably damaging
Transcript: ENSMUST00000034991
AA Change: S247R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: S247R

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87705623 missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87705661 missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87724331 missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87713543 missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87724408 missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87707859 missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87727406 missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87730829 missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87705580 missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87729653 missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87715516 splice site probably benign
R0374:Tbx18 UTSW 9 87724355 missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87724409 missense probably benign 0.13
R2141:Tbx18 UTSW 9 87715653 missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87705736 missense probably damaging 0.98
R2234:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87729636 missense probably benign
R4214:Tbx18 UTSW 9 87724465 missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87730769 missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87727449 missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87715687 missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87713513 missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87715535 nonsense probably null
R6659:Tbx18 UTSW 9 87707811 missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87727404 missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87705264 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTCTCTGATACAAATACAACCTTG -3'
(R):5'- TATTGGAAAAGGGTGCACACTTG -3'

Sequencing Primer
(F):5'- GATACAAATACAACCTTGATTTGGC -3'
(R):5'- GTTGTTAATTCCAAGGAATGCACAG -3'
Posted On2014-10-15