Incidental Mutation 'R2233:Tnk1'
ID240199
Institutional Source Beutler Lab
Gene Symbol Tnk1
Ensembl Gene ENSMUSG00000001583
Gene Nametyrosine kinase, non-receptor, 1
SynonymsTnk1a, Kos1, Tnk1b
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69851005-69858730 bp(-) (GRCm38)
Type of Mutationunclassified (3133 bp from exon)
DNA Base Change (assembly) C to T at 69855191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108626] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000125571] [ENSMUST00000156507]
Predicted Effect probably damaging
Transcript: ENSMUST00000001626
AA Change: A303T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583
AA Change: A303T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000019605
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108626
AA Change: A303T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104266
Gene: ENSMUSG00000001583
AA Change: A303T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 6e-6 BLAST
TyrKc 116 378 1.2e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108628
AA Change: A303T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583
AA Change: A303T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108632
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108633
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125571
SMART Domains Protein: ENSMUSP00000118490
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 72 2e-6 BLAST
Pfam:Pkinase 116 268 3.3e-21 PFAM
Pfam:Pkinase_Tyr 116 268 1.9e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156507
AA Change: A42T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583
AA Change: A42T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tyrosine protein kinase family. Tyrosine protein kinases are important regulators of intracellular signal transduction pathways, mediating cellular proliferation, survival, and development. This gene is highly expressed in fetal tissues and at lower levels in few adult tissues, thus may function in signaling pathways utilized broadly during fetal development, and more selectively in adult tissues. It plays a negative regulatory role in the Ras-Raf1-MAPK pathway, and knockout mice have been shown to develop spontaneous tumors, suggesting a role as a tumor suppressor gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice either heterozygous or homozygous for a knock-out allele develop spontaneous tumors, including lymphomas and carcinomas, at high rates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Tnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Tnk1 APN 11 69855905 unclassified probably benign
IGL02668:Tnk1 APN 11 69856923 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0389:Tnk1 UTSW 11 69855682 missense probably damaging 1.00
R0529:Tnk1 UTSW 11 69855164 missense probably damaging 1.00
R1396:Tnk1 UTSW 11 69853136 missense probably benign 0.01
R1436:Tnk1 UTSW 11 69852293 splice site probably benign
R1494:Tnk1 UTSW 11 69856546 missense possibly damaging 0.60
R1687:Tnk1 UTSW 11 69856473 missense possibly damaging 0.75
R1752:Tnk1 UTSW 11 69856706 missense possibly damaging 0.92
R1832:Tnk1 UTSW 11 69856928 missense probably damaging 0.99
R2109:Tnk1 UTSW 11 69855183 missense probably damaging 1.00
R2234:Tnk1 UTSW 11 69855191 unclassified probably null
R2423:Tnk1 UTSW 11 69855761 missense probably damaging 0.98
R3018:Tnk1 UTSW 11 69854911 intron probably benign
R3689:Tnk1 UTSW 11 69855599 missense probably damaging 1.00
R4746:Tnk1 UTSW 11 69855166 missense probably damaging 1.00
R5653:Tnk1 UTSW 11 69853585 missense probably damaging 1.00
R6060:Tnk1 UTSW 11 69853593 missense possibly damaging 0.78
R6154:Tnk1 UTSW 11 69856954 missense probably damaging 1.00
X0061:Tnk1 UTSW 11 69852272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCACCTCTTGAAGCAGCC -3'
(R):5'- GTCATCAGGTCAAGAGGCAC -3'

Sequencing Primer
(F):5'- AAGCAGCCCTTCCAGGTTG -3'
(R):5'- CACAGAAAGGATTTTTGAGGCTAATG -3'
Posted On2014-10-15