Incidental Mutation 'R0164:Tnks1bp1'
ID24021
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0164 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85059221 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 631 (P631S)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111605
AA Change: P631S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: P631S

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf1 T A 9: 106,844,145 S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Klc3 T A 7: 19,394,926 N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tcp1 T A 17: 12,922,747 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tomm70a T C 16: 57,147,821 V517A probably damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Ulk3 T A 9: 57,590,686 I90N probably damaging Het
Unc13c T C 9: 73,694,892 I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAAGCTGACAGTTGGGCTGTATC -3'
(R):5'- AGCCATCGAGAACTGCTTTCAGG -3'

Sequencing Primer
(F):5'- TTCAGGGAAATGATCCAGGCATATC -3'
(R):5'- TGTAGGCTCAGGAGACACACT -3'
Posted On2013-04-16