Incidental Mutation 'R2238:Adgrl4'
ID240222
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission 040238-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2238 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151500142 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 164 (I164F)
Ref Sequence ENSEMBL: ENSMUSP00000143744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977] [ENSMUST00000196970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046977
AA Change: I214F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167
AA Change: I214F

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155652
Predicted Effect probably damaging
Transcript: ENSMUST00000196970
AA Change: I164F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143744
Gene: ENSMUSG00000039167
AA Change: I164F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 21 57 4.5e-2 SMART
EGF_CA 58 107 2.5e-11 SMART
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,899 V5E possibly damaging Het
Acaca T C 11: 84,391,505 probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Bmi1 T C 2: 18,683,414 probably benign Het
Carf T C 1: 60,148,034 S599P probably benign Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Clca3a1 T A 3: 144,752,005 I373F possibly damaging Het
Clnk A G 5: 38,764,351 probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Dact2 A T 17: 14,197,050 L296Q probably damaging Het
Dctn2 C T 10: 127,276,388 T123I probably damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dnmbp A G 19: 43,868,864 V957A possibly damaging Het
Emilin2 T C 17: 71,274,739 R331G possibly damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gcc1 A G 6: 28,420,463 V285A probably benign Het
Gopc T C 10: 52,353,403 H188R probably damaging Het
Herc6 A G 6: 57,654,401 N693D probably benign Het
Hipk2 A G 6: 38,729,915 probably benign Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ints1 G A 5: 139,765,200 T814M possibly damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kdr T A 5: 75,949,519 Y936F possibly damaging Het
Ly6k T C 15: 74,797,169 E87G probably benign Het
Lyst A G 13: 13,743,263 N3303D probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Msl2 T A 9: 101,101,370 N314K probably benign Het
Ncapd3 A G 9: 27,067,024 T840A probably benign Het
Neil3 T C 8: 53,599,276 D429G possibly damaging Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5c1b A G 12: 10,390,108 Y550C probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Pabpc4l A C 3: 46,446,702 V169G probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Ptprz1 A T 6: 22,987,377 Q387L probably damaging Het
Rassf8 T C 6: 145,817,184 V419A probably damaging Het
Rnf148 T C 6: 23,654,346 Y217C probably benign Het
Sec24d T A 3: 123,349,894 probably null Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Sgcd T C 11: 47,132,682 N99D possibly damaging Het
Sncaip T C 18: 52,868,547 S47P probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Srcin1 T C 11: 97,534,819 T471A probably benign Het
Stac G A 9: 111,690,122 probably benign Het
Tcaf3 A G 6: 42,593,328 Y497H probably benign Het
Tmem40 C T 6: 115,731,077 W150* probably null Het
Tmem59l T C 8: 70,485,122 T203A probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Vmn1r204 A G 13: 22,556,823 H208R probably benign Het
Vmn2r98 T A 17: 19,065,951 M237K probably damaging Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2474:Adgrl4 UTSW 3 151542724 missense probably benign 0.01
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4640:Adgrl4 UTSW 3 151500310 unclassified probably benign
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5428:Adgrl4 UTSW 3 151542686 missense probably damaging 1.00
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6106:Adgrl4 UTSW 3 151540985 missense possibly damaging 0.67
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R6887:Adgrl4 UTSW 3 151542733 missense possibly damaging 0.46
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCGACCACTTAAATCTTATGTG -3'
(R):5'- GATTTGTCGGTAACTGGTCCCAC -3'

Sequencing Primer
(F):5'- GTGTAAAATCCTCCCACAGAAATGTG -3'
(R):5'- GGTAACTGGTCCCACATTTTATG -3'
Posted On2014-10-15