Incidental Mutation 'R2238:Ints1'
ID240226
Institutional Source Beutler Lab
Gene Symbol Ints1
Ensembl Gene ENSMUSG00000029547
Gene Nameintegrator complex subunit 1
Synonyms1110015K06Rik
MMRRC Submission 040238-MU
Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2238 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139751282-139775674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139765200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 814 (T814M)
Ref Sequence ENSEMBL: ENSMUSP00000072406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000200393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072607
AA Change: T814M

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: T814M

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200339
Predicted Effect possibly damaging
Transcript: ENSMUST00000200393
AA Change: T816M

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: T816M

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,899 V5E possibly damaging Het
Acaca T C 11: 84,391,505 probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Bmi1 T C 2: 18,683,414 probably benign Het
Carf T C 1: 60,148,034 S599P probably benign Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Clca3a1 T A 3: 144,752,005 I373F possibly damaging Het
Clnk A G 5: 38,764,351 probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Dact2 A T 17: 14,197,050 L296Q probably damaging Het
Dctn2 C T 10: 127,276,388 T123I probably damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dnmbp A G 19: 43,868,864 V957A possibly damaging Het
Emilin2 T C 17: 71,274,739 R331G possibly damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gcc1 A G 6: 28,420,463 V285A probably benign Het
Gopc T C 10: 52,353,403 H188R probably damaging Het
Herc6 A G 6: 57,654,401 N693D probably benign Het
Hipk2 A G 6: 38,729,915 probably benign Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kdr T A 5: 75,949,519 Y936F possibly damaging Het
Ly6k T C 15: 74,797,169 E87G probably benign Het
Lyst A G 13: 13,743,263 N3303D probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Msl2 T A 9: 101,101,370 N314K probably benign Het
Ncapd3 A G 9: 27,067,024 T840A probably benign Het
Neil3 T C 8: 53,599,276 D429G possibly damaging Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5c1b A G 12: 10,390,108 Y550C probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Pabpc4l A C 3: 46,446,702 V169G probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Ptprz1 A T 6: 22,987,377 Q387L probably damaging Het
Rassf8 T C 6: 145,817,184 V419A probably damaging Het
Rnf148 T C 6: 23,654,346 Y217C probably benign Het
Sec24d T A 3: 123,349,894 probably null Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Sgcd T C 11: 47,132,682 N99D possibly damaging Het
Sncaip T C 18: 52,868,547 S47P probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Srcin1 T C 11: 97,534,819 T471A probably benign Het
Stac G A 9: 111,690,122 probably benign Het
Tcaf3 A G 6: 42,593,328 Y497H probably benign Het
Tmem40 C T 6: 115,731,077 W150* probably null Het
Tmem59l T C 8: 70,485,122 T203A probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Vmn1r204 A G 13: 22,556,823 H208R probably benign Het
Vmn2r98 T A 17: 19,065,951 M237K probably damaging Het
Other mutations in Ints1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ints1 APN 5 139771682 missense probably damaging 0.99
IGL01329:Ints1 APN 5 139767503 splice site probably benign
IGL01414:Ints1 APN 5 139758498 missense probably benign
IGL01612:Ints1 APN 5 139756292 missense probably benign 0.17
IGL01726:Ints1 APN 5 139768411 splice site probably benign
IGL01958:Ints1 APN 5 139760088 missense possibly damaging 0.94
IGL02122:Ints1 APN 5 139765150 nonsense probably null
IGL02149:Ints1 APN 5 139751960 missense probably damaging 1.00
IGL02349:Ints1 APN 5 139768468 missense probably damaging 0.96
IGL02557:Ints1 APN 5 139771637 missense probably damaging 1.00
IGL02814:Ints1 APN 5 139772391 missense possibly damaging 0.80
IGL02815:Ints1 APN 5 139755282 missense probably damaging 0.96
IGL02825:Ints1 APN 5 139764739 missense probably benign 0.32
IGL03000:Ints1 APN 5 139766506 missense probably benign 0.01
IGL03164:Ints1 APN 5 139752735 missense probably damaging 0.99
A9681:Ints1 UTSW 5 139770139 missense possibly damaging 0.56
R0113:Ints1 UTSW 5 139765213 missense probably benign 0.01
R0193:Ints1 UTSW 5 139751730 missense probably damaging 1.00
R0372:Ints1 UTSW 5 139772438 missense probably damaging 1.00
R1129:Ints1 UTSW 5 139758471 missense probably benign 0.00
R1290:Ints1 UTSW 5 139771410 nonsense probably null
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1691:Ints1 UTSW 5 139768932 missense probably damaging 1.00
R1708:Ints1 UTSW 5 139762839 missense probably damaging 1.00
R1791:Ints1 UTSW 5 139774522 missense probably benign 0.04
R2066:Ints1 UTSW 5 139767496 missense probably benign 0.14
R2102:Ints1 UTSW 5 139755999 missense possibly damaging 0.50
R2108:Ints1 UTSW 5 139767750 missense probably damaging 1.00
R2426:Ints1 UTSW 5 139771814 critical splice donor site probably null
R2913:Ints1 UTSW 5 139757913 missense possibly damaging 0.91
R3896:Ints1 UTSW 5 139757644 nonsense probably null
R4608:Ints1 UTSW 5 139759844 missense probably benign 0.13
R4658:Ints1 UTSW 5 139774299 missense possibly damaging 0.88
R4797:Ints1 UTSW 5 139771876 missense possibly damaging 0.85
R4887:Ints1 UTSW 5 139771156 missense possibly damaging 0.66
R4944:Ints1 UTSW 5 139758092 splice site probably null
R4956:Ints1 UTSW 5 139757130 missense probably damaging 1.00
R4976:Ints1 UTSW 5 139752811 missense probably damaging 1.00
R5283:Ints1 UTSW 5 139764382 missense probably damaging 1.00
R5354:Ints1 UTSW 5 139766428 critical splice donor site probably null
R5496:Ints1 UTSW 5 139755198 missense probably benign 0.07
R5517:Ints1 UTSW 5 139752787 missense possibly damaging 0.86
R5696:Ints1 UTSW 5 139754989 missense probably benign 0.00
R5766:Ints1 UTSW 5 139772145 missense probably benign 0.33
R6359:Ints1 UTSW 5 139756217 missense probably benign 0.09
R6753:Ints1 UTSW 5 139765175 missense probably damaging 1.00
R6892:Ints1 UTSW 5 139767828 missense probably damaging 0.99
R7009:Ints1 UTSW 5 139768462 missense possibly damaging 0.83
R7047:Ints1 UTSW 5 139758471 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTTAGCTCTGCCTGTTCC -3'
(R):5'- AGACACTGGGGCTTAACTGG -3'

Sequencing Primer
(F):5'- CCTTCCACCCACACCTGG -3'
(R):5'- CACTGGGGCTTAACTGGGTAGC -3'
Posted On2014-10-15