Incidental Mutation 'R2238:Vmn2r98'
ID240266
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 040238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2238 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19065951 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 237 (M237K)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: M237K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: M237K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,899 V5E possibly damaging Het
Acaca T C 11: 84,391,505 probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Bmi1 T C 2: 18,683,414 probably benign Het
Carf T C 1: 60,148,034 S599P probably benign Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Clca3a1 T A 3: 144,752,005 I373F possibly damaging Het
Clnk A G 5: 38,764,351 probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Dact2 A T 17: 14,197,050 L296Q probably damaging Het
Dctn2 C T 10: 127,276,388 T123I probably damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dnmbp A G 19: 43,868,864 V957A possibly damaging Het
Emilin2 T C 17: 71,274,739 R331G possibly damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gcc1 A G 6: 28,420,463 V285A probably benign Het
Gopc T C 10: 52,353,403 H188R probably damaging Het
Herc6 A G 6: 57,654,401 N693D probably benign Het
Hipk2 A G 6: 38,729,915 probably benign Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ints1 G A 5: 139,765,200 T814M possibly damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kdr T A 5: 75,949,519 Y936F possibly damaging Het
Ly6k T C 15: 74,797,169 E87G probably benign Het
Lyst A G 13: 13,743,263 N3303D probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Msl2 T A 9: 101,101,370 N314K probably benign Het
Ncapd3 A G 9: 27,067,024 T840A probably benign Het
Neil3 T C 8: 53,599,276 D429G possibly damaging Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5c1b A G 12: 10,390,108 Y550C probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Pabpc4l A C 3: 46,446,702 V169G probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Ptprz1 A T 6: 22,987,377 Q387L probably damaging Het
Rassf8 T C 6: 145,817,184 V419A probably damaging Het
Rnf148 T C 6: 23,654,346 Y217C probably benign Het
Sec24d T A 3: 123,349,894 probably null Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Sgcd T C 11: 47,132,682 N99D possibly damaging Het
Sncaip T C 18: 52,868,547 S47P probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Srcin1 T C 11: 97,534,819 T471A probably benign Het
Stac G A 9: 111,690,122 probably benign Het
Tcaf3 A G 6: 42,593,328 Y497H probably benign Het
Tmem40 C T 6: 115,731,077 W150* probably null Het
Tmem59l T C 8: 70,485,122 T203A probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Vmn1r204 A G 13: 22,556,823 H208R probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTCTCCTGAGTGACCGTG -3'
(R):5'- GCTCCCATGGAATGAGTCTAATATG -3'

Sequencing Primer
(F):5'- GACCGTGGTCAGTATTCTTCTC -3'
(R):5'- CAGCTCTGTCAATAACATGATGTTC -3'
Posted On2014-10-15