Incidental Mutation 'R2240:Abl1'
ID240286
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31800505 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 679 (K679E)
Ref Sequence ENSEMBL: ENSMUSP00000075167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000142554]
Predicted Effect probably benign
Transcript: ENSMUST00000028190
AA Change: K660E

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: K660E

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075759
AA Change: K679E

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: K679E

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCGCTTTGATCAAGAAG -3'
(R):5'- GAGTCAAACTGCTTGCCAGC -3'

Sequencing Primer
(F):5'- TCAGCGCTTTGATCAAGAAGAAGAAG -3'
(R):5'- GACCGCCACTCTGTGTC -3'
Posted On2014-10-15