Incidental Mutation 'R2240:Tmcc1'
ID240312
Institutional Source Beutler Lab
Gene Symbol Tmcc1
Ensembl Gene ENSMUSG00000030126
Gene Nametransmembrane and coiled coil domains 1
Synonyms
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R2240 (G1)
Quality Score115
Status Not validated
Chromosome6
Chromosomal Location116018611-116193486 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) C to CAT at 116042870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088896] [ENSMUST00000172510] [ENSMUST00000173110] [ENSMUST00000173140] [ENSMUST00000173548] [ENSMUST00000204353]
Predicted Effect probably null
Transcript: ENSMUST00000032222
SMART Domains Protein: ENSMUSP00000032222
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 153 164 N/A INTRINSIC
Pfam:Tmemb_cc2 268 677 9.7e-170 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088896
SMART Domains Protein: ENSMUSP00000086285
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Pfam:Tmemb_cc2 227 636 2.3e-170 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172510
SMART Domains Protein: ENSMUSP00000133665
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 188 6.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172909
SMART Domains Protein: ENSMUSP00000134407
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173110
SMART Domains Protein: ENSMUSP00000133794
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173140
SMART Domains Protein: ENSMUSP00000134455
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 79 6.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173548
SMART Domains Protein: ENSMUSP00000145456
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 48 457 1.5e-167 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204353
SMART Domains Protein: ENSMUSP00000144971
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 52 461 8.3e-171 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Tmcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmcc1 APN 6 116043027 missense probably damaging 0.99
IGL01580:Tmcc1 APN 6 116042985 missense possibly damaging 0.91
IGL02858:Tmcc1 APN 6 116133888 missense probably damaging 0.99
IGL03226:Tmcc1 APN 6 116133976 missense probably damaging 0.99
FR4976:Tmcc1 UTSW 6 116193380 start gained probably benign
IGL02988:Tmcc1 UTSW 6 116042928 missense probably damaging 1.00
R0522:Tmcc1 UTSW 6 116042870 frame shift probably null
R0654:Tmcc1 UTSW 6 116042990 missense probably benign 0.03
R0721:Tmcc1 UTSW 6 116042870 frame shift probably null
R1392:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R1573:Tmcc1 UTSW 6 116133963 missense probably damaging 0.99
R1644:Tmcc1 UTSW 6 116133865 missense probably damaging 1.00
R2062:Tmcc1 UTSW 6 116043058 missense probably benign 0.01
R2065:Tmcc1 UTSW 6 116042870 frame shift probably null
R2214:Tmcc1 UTSW 6 116042870 frame shift probably null
R2399:Tmcc1 UTSW 6 116042870 frame shift probably null
R3683:Tmcc1 UTSW 6 116042870 frame shift probably null
R3722:Tmcc1 UTSW 6 116133822 missense possibly damaging 0.83
R3926:Tmcc1 UTSW 6 116042913 missense probably damaging 1.00
R4082:Tmcc1 UTSW 6 116043480 missense probably damaging 1.00
R4155:Tmcc1 UTSW 6 116133804 missense probably benign 0.18
R4619:Tmcc1 UTSW 6 116043286 missense probably damaging 1.00
R5246:Tmcc1 UTSW 6 116043420 missense probably damaging 1.00
R5568:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R6364:Tmcc1 UTSW 6 116043761 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGCGTTAAAGTCATAAACTGGG -3'
(R):5'- CTCAGTAGGAGCCAACAGTACC -3'

Sequencing Primer
(F):5'- AAGAAATGTTGCATCTGTGTGTGATC -3'
(R):5'- AGTACCACTGGGGGCATTG -3'
Posted On2014-10-15