Incidental Mutation 'R2240:Olfr866'
ID240323
Institutional Source Beutler Lab
Gene Symbol Olfr866
Ensembl Gene ENSMUSG00000050803
Gene Nameolfactory receptor 866
SynonymsMOR145-5, GA_x6K02T2PVTD-13768406-13767468
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20026959-20028035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20027144 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 265 (S265P)
Ref Sequence ENSEMBL: ENSMUSP00000054864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062248]
Predicted Effect probably damaging
Transcript: ENSMUST00000062248
AA Change: S265P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054864
Gene: ENSMUSG00000050803
AA Change: S265P

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 2e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 282 8.7e-7 PFAM
Pfam:7tm_1 44 293 5.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212071
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Olfr866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr866 APN 9 20027047 missense probably damaging 1.00
IGL01554:Olfr866 APN 9 20027408 missense possibly damaging 0.55
IGL01561:Olfr866 APN 9 20027522 missense probably benign 0.20
IGL01597:Olfr866 APN 9 20027686 missense probably damaging 0.98
IGL02986:Olfr866 APN 9 20027711 missense probably benign 0.43
IGL03101:Olfr866 APN 9 20027429 missense probably benign 0.03
R0863:Olfr866 UTSW 9 20027213 missense probably damaging 1.00
R1747:Olfr866 UTSW 9 20027317 missense probably benign 0.01
R2121:Olfr866 UTSW 9 20027501 missense probably benign
R2124:Olfr866 UTSW 9 20027501 missense probably benign
R3793:Olfr866 UTSW 9 20027063 missense probably damaging 1.00
R4498:Olfr866 UTSW 9 20027733 missense possibly damaging 0.50
R5084:Olfr866 UTSW 9 20027255 missense probably damaging 0.99
R5420:Olfr866 UTSW 9 20027059 missense probably damaging 0.98
R6314:Olfr866 UTSW 9 20027662 missense probably damaging 0.98
R6357:Olfr866 UTSW 9 20027629 missense probably damaging 1.00
R6588:Olfr866 UTSW 9 20027866 missense probably damaging 0.97
R6886:Olfr866 UTSW 9 20027132 missense probably benign 0.00
R7480:Olfr866 UTSW 9 20027934 start codon destroyed probably null
Z1088:Olfr866 UTSW 9 20027279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAATTGGAAGACATAGGATGTG -3'
(R):5'- TCTTGCTTGTACTAACACACTCAG -3'

Sequencing Primer
(F):5'- GTGATATTAGGAAAACCTACTGTGG -3'
(R):5'- TTGTACTAACACACTCAGCAGTAAC -3'
Posted On2014-10-15