Incidental Mutation 'R2240:Nid2'
ID240339
Institutional Source Beutler Lab
Gene Symbol Nid2
Ensembl Gene ENSMUSG00000021806
Gene Namenidogen 2
Synonymsentactin 2, entactin-2
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location19751265-19811787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19805914 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1236 (D1236N)
Ref Sequence ENSEMBL: ENSMUSP00000022340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022340]
Predicted Effect probably damaging
Transcript: ENSMUST00000022340
AA Change: D1236N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806
AA Change: D1236N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Blast:NIDO 39 77 3e-11 BLAST
NIDO 108 276 1.12e-72 SMART
low complexity region 421 430 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
EGF 510 547 1.84e1 SMART
G2F 548 780 4.36e-143 SMART
EGF 785 823 2.52e-2 SMART
EGF_CA 824 866 1.45e-11 SMART
EGF 874 914 3.15e-3 SMART
EGF_CA 915 953 5.03e-11 SMART
TY 988 1037 8.27e-20 SMART
TY 1068 1116 1.19e-20 SMART
LY 1162 1204 1.15e-5 SMART
LY 1206 1248 8.82e-16 SMART
LY 1249 1293 1.51e-14 SMART
LY 1294 1336 3.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224057
Predicted Effect unknown
Transcript: ENSMUST00000224263
AA Change: D970N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225791
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Nid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Nid2 APN 14 19768677 missense probably benign
IGL01788:Nid2 APN 14 19807979 missense probably damaging 1.00
IGL02259:Nid2 APN 14 19768209 critical splice acceptor site probably null
IGL03084:Nid2 APN 14 19768932 missense probably benign 0.05
IGL03247:Nid2 APN 14 19779620 missense probably damaging 1.00
IGL03098:Nid2 UTSW 14 19805938 missense probably damaging 0.99
PIT4810001:Nid2 UTSW 14 19810090 missense possibly damaging 0.82
R0173:Nid2 UTSW 14 19802332 splice site probably benign
R0501:Nid2 UTSW 14 19789668 splice site probably null
R1117:Nid2 UTSW 14 19763664 critical splice acceptor site probably null
R1305:Nid2 UTSW 14 19768862 missense probably benign 0.00
R1572:Nid2 UTSW 14 19805412 missense probably benign 0.08
R1594:Nid2 UTSW 14 19781261 missense probably benign 0.03
R1789:Nid2 UTSW 14 19752431 missense possibly damaging 0.95
R1927:Nid2 UTSW 14 19768276 missense probably damaging 1.00
R2085:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2086:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2100:Nid2 UTSW 14 19778878 nonsense probably null
R2158:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2314:Nid2 UTSW 14 19789761 missense probably benign 0.01
R2863:Nid2 UTSW 14 19768403 missense possibly damaging 0.92
R3113:Nid2 UTSW 14 19778043 missense probably benign 0.12
R3545:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3548:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3801:Nid2 UTSW 14 19809997 missense probably damaging 1.00
R4618:Nid2 UTSW 14 19808010 missense probably damaging 0.99
R4798:Nid2 UTSW 14 19789761 missense probably benign 0.01
R4953:Nid2 UTSW 14 19778078 nonsense probably null
R5256:Nid2 UTSW 14 19768208 critical splice acceptor site probably null
R5289:Nid2 UTSW 14 19805311 missense possibly damaging 0.95
R5302:Nid2 UTSW 14 19779701 missense probably benign
R5409:Nid2 UTSW 14 19805962 missense probably damaging 1.00
R5514:Nid2 UTSW 14 19802467 missense probably damaging 1.00
R6134:Nid2 UTSW 14 19778783 missense probably damaging 1.00
R6365:Nid2 UTSW 14 19803133 missense probably damaging 1.00
R6647:Nid2 UTSW 14 19802416 missense probably benign 0.04
R6758:Nid2 UTSW 14 19802483 missense probably damaging 1.00
R6882:Nid2 UTSW 14 19789707 missense probably damaging 1.00
R6893:Nid2 UTSW 14 19789787 missense probably benign 0.34
R7045:Nid2 UTSW 14 19779681 missense possibly damaging 0.94
R7392:Nid2 UTSW 14 19768656 missense probably benign 0.00
R7477:Nid2 UTSW 14 19805973 missense probably benign 0.09
R7515:Nid2 UTSW 14 19791567 missense probably benign 0.06
R7547:Nid2 UTSW 14 19797277 missense probably benign
X0009:Nid2 UTSW 14 19802511 missense probably damaging 1.00
X0021:Nid2 UTSW 14 19768862 missense probably benign 0.00
X0026:Nid2 UTSW 14 19778131 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCCAGCACAGAAGAGACTG -3'
(R):5'- CCCATGACATATATAAGAGCCAGG -3'

Sequencing Primer
(F):5'- AAAAAGTTAGCCTTCGTCCTGGG -3'
(R):5'- TGACATATATAAGAGCCAGGGTCTCC -3'
Posted On2014-10-15