Incidental Mutation 'R2240:Brd4'
ID240354
Institutional Source Beutler Lab
Gene Symbol Brd4
Ensembl Gene ENSMUSG00000024002
Gene Namebromodomain containing 4
SynonymsHUNK1, MCAP, WI-11513
MMRRC Submission 040240-MU
Accession Numbers

Genbank: NM_020508.3; NM_198094.2; MGI: 1888520

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32196274-32284722 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 32213639 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003726] [ENSMUST00000114475] [ENSMUST00000119123] [ENSMUST00000120276] [ENSMUST00000121285] [ENSMUST00000125899] [ENSMUST00000127893]
Predicted Effect unknown
Transcript: ENSMUST00000003726
AA Change: K549E
SMART Domains Protein: ENSMUSP00000003726
Gene: ENSMUSG00000024002
AA Change: K549E

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1e-52 SMART
low complexity region 176 191 N/A INTRINSIC
low complexity region 198 224 N/A INTRINSIC
low complexity region 237 275 N/A INTRINSIC
low complexity region 295 305 N/A INTRINSIC
low complexity region 329 339 N/A INTRINSIC
BROMO 352 461 1.2e-48 SMART
coiled coil region 504 570 N/A INTRINSIC
Pfam:BET 611 675 6.4e-33 PFAM
low complexity region 701 722 N/A INTRINSIC
low complexity region 746 796 N/A INTRINSIC
low complexity region 828 854 N/A INTRINSIC
low complexity region 890 926 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
low complexity region 953 1005 N/A INTRINSIC
low complexity region 1013 1042 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1201 1212 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
coiled coil region 1261 1345 N/A INTRINSIC
Pfam:BRD4_CDT 1358 1400 3.8e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114475
AA Change: K548E
SMART Domains Protein: ENSMUSP00000110119
Gene: ENSMUSG00000024002
AA Change: K548E

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 3e-46 PDB
low complexity region 700 720 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119123
AA Change: K548E
SMART Domains Protein: ENSMUSP00000113197
Gene: ENSMUSG00000024002
AA Change: K548E

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120276
AA Change: K548E
SMART Domains Protein: ENSMUSP00000112474
Gene: ENSMUSG00000024002
AA Change: K548E

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 3e-46 PDB
low complexity region 700 721 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121285
AA Change: K548E
SMART Domains Protein: ENSMUSP00000113070
Gene: ENSMUSG00000024002
AA Change: K548E

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125899
SMART Domains Protein: ENSMUSP00000115277
Gene: ENSMUSG00000024002

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 144 5.02e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127893
AA Change: K548E
SMART Domains Protein: ENSMUSP00000115163
Gene: ENSMUSG00000024002
AA Change: K548E

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 531 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 2674141
Lethality: E3-E8
FUNCTION: This gene was temporarily named bromodomain-containing 5 (Brd5) and was renamed bromodomain-containing 4 (Brd4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trap null mutation die soon after implantation. Heterozygotes exhibit impaired pre- and postnatal growth, head malformations, lack of subcutaneous fat, cataracts, and abnormal liver cells. [provided by MGI curators]
Allele List at MGI

All alleles(161) : Targeted(1) Gene trapped(160)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Brd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Brd4 APN 17 32198675 splice site probably benign
IGL01758:Brd4 APN 17 32212829 unclassified probably benign
IGL02750:Brd4 APN 17 32198379 unclassified probably benign
IGL03066:Brd4 APN 17 32199088 intron probably benign
IGL03338:Brd4 APN 17 32213072 missense probably damaging 1.00
H8562:Brd4 UTSW 17 32229403 splice site probably benign
P0035:Brd4 UTSW 17 32212838 critical splice donor site probably null
R0243:Brd4 UTSW 17 32224123 missense probably benign 0.15
R0281:Brd4 UTSW 17 32213540 unclassified probably benign
R0331:Brd4 UTSW 17 32202515 missense probably benign 0.01
R0722:Brd4 UTSW 17 32212982 missense possibly damaging 0.76
R0750:Brd4 UTSW 17 32220252 missense probably benign 0.09
R1544:Brd4 UTSW 17 32198672 splice site probably benign
R1920:Brd4 UTSW 17 32198086 unclassified probably benign
R1922:Brd4 UTSW 17 32198086 unclassified probably benign
R1957:Brd4 UTSW 17 32221366 missense possibly damaging 0.50
R2316:Brd4 UTSW 17 32212910 missense probably benign 0.03
R2333:Brd4 UTSW 17 32221457 missense probably damaging 0.97
R3809:Brd4 UTSW 17 32211270 missense possibly damaging 0.72
R4273:Brd4 UTSW 17 32214782 missense probably benign
R4595:Brd4 UTSW 17 32198922 missense probably damaging 0.97
R4854:Brd4 UTSW 17 32220237 missense probably damaging 0.96
R4923:Brd4 UTSW 17 32199240 missense probably benign 0.38
R5014:Brd4 UTSW 17 32198398 unclassified probably benign
R5757:Brd4 UTSW 17 32201298 unclassified probably benign
R5979:Brd4 UTSW 17 32198726 missense probably benign 0.32
R6212:Brd4 UTSW 17 32202449 missense probably damaging 0.98
R6394:Brd4 UTSW 17 32224147 nonsense probably null
R6643:Brd4 UTSW 17 32198496 missense unknown
R7024:Brd4 UTSW 17 32221910 utr 3 prime probably benign
R7033:Brd4 UTSW 17 32199015 missense probably benign 0.13
R7220:Brd4 UTSW 17 32225583 missense unknown
X0064:Brd4 UTSW 17 32201127 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAACAGGGTTGTCTTCCTC -3'
(R):5'- AGAACATTTAGTCCTGGTAGTGGG -3'

Sequencing Primer
(F):5'- AGGGTTGTCTTCCTCCCTACAAATC -3'
(R):5'- GCAGGTTCCCACTAAAAGTTTGGC -3'
Posted On2014-10-15