Incidental Mutation 'R2240:Rbbp8'
ID240357
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Nameretinoblastoma binding protein 8, endonuclease
Synonyms9930104E21Rik, CtIP
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location11633276-11743207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11677669 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 76 (T76I)
Ref Sequence ENSEMBL: ENSMUSP00000111527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
Predicted Effect probably damaging
Transcript: ENSMUST00000047322
AA Change: T76I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: T76I

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115861
AA Change: T76I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: T76I

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11722607 missense probably benign
IGL01302:Rbbp8 APN 18 11721979 missense probably benign
IGL01965:Rbbp8 APN 18 11722260 missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11705819 missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11732212 missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11732213 missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11738614 missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11705812 missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11725502 splice site probably benign
IGL03274:Rbbp8 APN 18 11741076 splice site probably benign
IGL03367:Rbbp8 APN 18 11721719 missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0167:Rbbp8 UTSW 18 11660922 nonsense probably null
R0314:Rbbp8 UTSW 18 11715818 missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11732184 splice site probably benign
R1033:Rbbp8 UTSW 18 11742705 missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11732315 missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11742679 missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11727166 splice site probably benign
R2015:Rbbp8 UTSW 18 11720624 missense probably benign 0.01
R2308:Rbbp8 UTSW 18 11696776 missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11718868 missense probably benign
R4375:Rbbp8 UTSW 18 11725410 missense probably benign 0.00
R4590:Rbbp8 UTSW 18 11732265 nonsense probably null
R4695:Rbbp8 UTSW 18 11721782 nonsense probably null
R4769:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R5161:Rbbp8 UTSW 18 11722114 missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11722151 missense probably benign 0.00
R5223:Rbbp8 UTSW 18 11721690 missense probably benign 0.19
R5573:Rbbp8 UTSW 18 11722607 missense probably benign
R5671:Rbbp8 UTSW 18 11742642 missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11738607 missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11718908 missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11732220 missense possibly damaging 0.92
R7261:Rbbp8 UTSW 18 11705742 missense probably damaging 0.99
R7305:Rbbp8 UTSW 18 11672581 critical splice acceptor site probably null
R7319:Rbbp8 UTSW 18 11732212 missense probably damaging 1.00
R7447:Rbbp8 UTSW 18 11660877 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCACTAGTGCAGATGCCATTC -3'
(R):5'- AAAACCTAGCAGTATATTGTCAGCC -3'

Sequencing Primer
(F):5'- TATTCTGCCCGCATGCAAGAAG -3'
(R):5'- AGCAGTATATTGTCAGCCTTATAAAG -3'
Posted On2014-10-15