Incidental Mutation 'R0164:Klc3'
ID24038
Institutional Source Beutler Lab
Gene Symbol Klc3
Ensembl Gene ENSMUSG00000040714
Gene Namekinesin light chain 3
Synonyms
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0164 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location19394437-19404104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19394926 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 469 (N469Y)
Ref Sequence ENSEMBL: ENSMUSP00000104097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047170] [ENSMUST00000062831] [ENSMUST00000108457] [ENSMUST00000108458] [ENSMUST00000108459] [ENSMUST00000108460] [ENSMUST00000108461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047170
AA Change: N469Y

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038091
Gene: ENSMUSG00000040714
AA Change: N469Y

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062831
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108457
AA Change: N469Y

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104097
Gene: ENSMUSG00000040714
AA Change: N469Y

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.7e-57 PFAM
Pfam:TPR_10 206 247 3.2e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108458
AA Change: N469Y

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104098
Gene: ENSMUSG00000040714
AA Change: N469Y

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108459
AA Change: N469Y

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104099
Gene: ENSMUSG00000040714
AA Change: N469Y

DomainStartEndE-ValueType
coiled coil region 88 150 N/A INTRINSIC
low complexity region 157 173 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
Pfam:TPR_10 206 247 5.6e-7 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108460
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108461
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128167
Predicted Effect probably benign
Transcript: ENSMUST00000129249
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180691
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin light chain gene family. Kinesins are molecular motors involved in the transport of cargo along microtubules, and are composed of two kinesin heavy chain (KHC) and two kinesin light chain (KLC) molecules. KLCs are thought to typically be involved in binding cargo and regulating kinesin activity. In the rat, a protein similar to this gene product is expressed in post-meiotic spermatids, where it associates with structural components of sperm tails and mitochondria. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf1 T A 9: 106,844,145 S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tcp1 T A 17: 12,922,747 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 P631S possibly damaging Het
Tomm70a T C 16: 57,147,821 V517A probably damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Ulk3 T A 9: 57,590,686 I90N probably damaging Het
Unc13c T C 9: 73,694,892 I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Klc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Klc3 APN 7 19396295 missense possibly damaging 0.78
IGL02215:Klc3 APN 7 19395825 missense probably damaging 1.00
IGL02530:Klc3 APN 7 19397044 missense probably benign 0.11
IGL03062:Klc3 APN 7 19395062 missense probably damaging 1.00
IGL02802:Klc3 UTSW 7 19395124 missense possibly damaging 0.86
R0164:Klc3 UTSW 7 19394926 missense possibly damaging 0.68
R1864:Klc3 UTSW 7 19398041 missense probably damaging 0.98
R4702:Klc3 UTSW 7 19395831 missense probably damaging 1.00
R5301:Klc3 UTSW 7 19396349 missense probably damaging 1.00
R5436:Klc3 UTSW 7 19397959 splice site probably null
R5497:Klc3 UTSW 7 19394670 missense probably benign
R5523:Klc3 UTSW 7 19397007 missense probably damaging 1.00
R5672:Klc3 UTSW 7 19396331 missense probably damaging 1.00
R5822:Klc3 UTSW 7 19395799 critical splice donor site probably null
R6576:Klc3 UTSW 7 19397980 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATTGGAGCCACTTCATGCCCTG -3'
(R):5'- ATGTCCCCACACATCACTGTGC -3'

Sequencing Primer
(F):5'- CATGCCCTGCCCACCAG -3'
(R):5'- GCAGGAGCAGTTCCTTCTCTAAG -3'
Posted On2013-04-16