Incidental Mutation 'R2235:Ubp1'
ID240403
Institutional Source Beutler Lab
Gene Symbol Ubp1
Ensembl Gene ENSMUSG00000009741
Gene Nameupstream binding protein 1
SynonymsNF2d9, LBP-1b, LBP-1a
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location113930934-113977202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113964644 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 340 (S340R)
Ref Sequence ENSEMBL: ENSMUSP00000150023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009885] [ENSMUST00000084885] [ENSMUST00000116492] [ENSMUST00000117537] [ENSMUST00000214095] [ENSMUST00000216558]
Predicted Effect probably damaging
Transcript: ENSMUST00000009885
AA Change: S304R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009885
Gene: ENSMUSG00000009741
AA Change: S304R

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084885
AA Change: S340R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081946
Gene: ENSMUSG00000009741
AA Change: S340R

DomainStartEndE-ValueType
Pfam:CP2 42 257 3e-62 PFAM
SCOP:d1kw4a_ 369 417 6e-3 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116492
AA Change: S304R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112192
Gene: ENSMUSG00000009741
AA Change: S304R

DomainStartEndE-ValueType
Pfam:CP2 37 259 1.6e-76 PFAM
SCOP:d1kw4a_ 333 381 5e-3 SMART
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117537
SMART Domains Protein: ENSMUSP00000114075
Gene: ENSMUSG00000032507

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214095
AA Change: S304R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216293
Predicted Effect probably damaging
Transcript: ENSMUST00000216558
AA Change: S340R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Ubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Ubp1 APN 9 113956758 missense probably damaging 1.00
IGL01951:Ubp1 APN 9 113951618 nonsense probably null
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0097:Ubp1 UTSW 9 113973507 splice site probably benign
R0241:Ubp1 UTSW 9 113966587 critical splice donor site probably null
R0669:Ubp1 UTSW 9 113964668 splice site probably benign
R0709:Ubp1 UTSW 9 113944931 missense probably damaging 1.00
R1416:Ubp1 UTSW 9 113970171 missense probably benign 0.02
R1466:Ubp1 UTSW 9 113944835 splice site probably benign
R1753:Ubp1 UTSW 9 113955969 missense possibly damaging 0.74
R1780:Ubp1 UTSW 9 113964579 missense possibly damaging 0.84
R3418:Ubp1 UTSW 9 113951686 critical splice donor site probably null
R3978:Ubp1 UTSW 9 113956705 critical splice acceptor site probably null
R4024:Ubp1 UTSW 9 113944883 missense probably benign 0.03
R4469:Ubp1 UTSW 9 113958707 missense probably benign 0.11
R4797:Ubp1 UTSW 9 113956002 missense probably damaging 1.00
R4984:Ubp1 UTSW 9 113959392 missense probably damaging 0.97
R5914:Ubp1 UTSW 9 113956739 missense probably benign 0.00
R6971:Ubp1 UTSW 9 113972763 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTGGGAATCTTGAGTTTATACGGG -3'
(R):5'- TGCTTCTCTGCAGTTACTGTAATG -3'

Sequencing Primer
(F):5'- AATCTTGAGTTTATACGGGCTCAG -3'
(R):5'- CTGCAGTTACTGTAATGTCAATGTG -3'
Posted On2014-10-15