Incidental Mutation 'R2235:Zkscan6'
ID240404
Institutional Source Beutler Lab
Gene Symbol Zkscan6
Ensembl Gene ENSMUSG00000018347
Gene Namezinc finger with KRAB and SCAN domains 6
Synonyms1700128E15Rik, Zfp535, KOX11, D11Ertd714e
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65807175-65829239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65828272 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 373 (S373P)
Ref Sequence ENSEMBL: ENSMUSP00000071406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018491] [ENSMUST00000071465] [ENSMUST00000080665]
Predicted Effect probably benign
Transcript: ENSMUST00000018491
AA Change: S373P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018491
Gene: ENSMUSG00000018347
AA Change: S373P

DomainStartEndE-ValueType
SCAN 37 149 2.75e-57 SMART
KRAB 223 280 4.18e-3 SMART
ZnF_C2H2 415 437 1.08e-1 SMART
ZnF_C2H2 443 465 4.72e-2 SMART
ZnF_C2H2 471 493 1.67e-2 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071465
AA Change: S373P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071406
Gene: ENSMUSG00000018347
AA Change: S373P

DomainStartEndE-ValueType
SCAN 37 149 2.75e-57 SMART
KRAB 223 280 4.18e-3 SMART
ZnF_C2H2 415 437 1.08e-1 SMART
ZnF_C2H2 443 465 4.72e-2 SMART
ZnF_C2H2 471 493 1.67e-2 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080665
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152386
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Other mutations in Zkscan6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zkscan6 APN 11 65828461 missense possibly damaging 0.96
IGL00941:Zkscan6 APN 11 65814747 missense probably damaging 1.00
IGL01784:Zkscan6 APN 11 65814721 missense probably damaging 1.00
IGL02423:Zkscan6 APN 11 65828294 missense probably benign 0.00
IGL03001:Zkscan6 APN 11 65814669 missense probably damaging 1.00
R0105:Zkscan6 UTSW 11 65821985 missense probably damaging 1.00
R0105:Zkscan6 UTSW 11 65821985 missense probably damaging 1.00
R0112:Zkscan6 UTSW 11 65814863 splice site probably benign
R0542:Zkscan6 UTSW 11 65828699 missense possibly damaging 0.92
R1636:Zkscan6 UTSW 11 65814430 start gained probably benign
R3926:Zkscan6 UTSW 11 65828225 missense probably benign
R6083:Zkscan6 UTSW 11 65815931 missense probably damaging 1.00
R6277:Zkscan6 UTSW 11 65828157 missense probably benign 0.00
R6558:Zkscan6 UTSW 11 65828225 missense probably benign
R6733:Zkscan6 UTSW 11 65828635 missense probably damaging 0.99
R7301:Zkscan6 UTSW 11 65828225 missense probably benign
R7432:Zkscan6 UTSW 11 65814363 critical splice acceptor site probably null
R7466:Zkscan6 UTSW 11 65828531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGGAAAATCACAGGGACCAG -3'
(R):5'- ATGCTTGTCAAGGCTGGAGC -3'

Sequencing Primer
(F):5'- TCACAGGGACCAGGGATGTC -3'
(R):5'- GGCAATGAAAGTATGTCTCTCCCG -3'
Posted On2014-10-15