Incidental Mutation 'R2235:Prph2'
ID 240418
Institutional Source Beutler Lab
Gene Symbol Prph2
Ensembl Gene ENSMUSG00000023978
Gene Name peripherin 2
Synonyms Tspan22, Rd2, Nmf193, rds
MMRRC Submission 040236-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2235 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 47221404-47235859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 47222092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 157 (D157V)
Ref Sequence ENSEMBL: ENSMUSP00000024773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024773]
AlphaFold P15499
Predicted Effect probably damaging
Transcript: ENSMUST00000024773
AA Change: D157V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: D157V

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 288 2.2e-28 PFAM
low complexity region 333 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,619,023 (GRCm39) V256A probably benign Het
Acbd6 A G 1: 155,434,454 (GRCm39) D24G probably damaging Het
Adcy2 A T 13: 68,816,611 (GRCm39) Y792N probably damaging Het
Alpk1 T C 3: 127,474,569 (GRCm39) K478R probably benign Het
Atad2b T G 12: 5,056,745 (GRCm39) F867C probably damaging Het
Bach1 A G 16: 87,517,001 (GRCm39) D514G probably damaging Het
BC035947 A T 1: 78,474,599 (GRCm39) D644E probably damaging Het
Chrm4 A G 2: 91,758,875 (GRCm39) S428G probably benign Het
Clca3a1 G T 3: 144,714,829 (GRCm39) P596Q possibly damaging Het
Cldn34b3 A T X: 75,310,830 (GRCm39) I133F probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Crh A T 3: 19,748,096 (GRCm39) M182K probably damaging Het
Csta1 C T 16: 35,945,445 (GRCm39) V23I probably damaging Het
Cts6 T A 13: 61,343,247 (GRCm39) I325F probably damaging Het
Dnah6 T C 6: 73,077,068 (GRCm39) D2347G probably damaging Het
Dync1i2 C T 2: 71,079,764 (GRCm39) Q419* probably null Het
E2f4 T A 8: 106,025,283 (GRCm39) V121E probably damaging Het
Fhip1a A T 3: 85,568,408 (GRCm39) L1037Q probably damaging Het
Fndc11 A G 2: 180,864,067 (GRCm39) S291G possibly damaging Het
Hid1 A G 11: 115,241,945 (GRCm39) I555T probably damaging Het
Hyou1 C T 9: 44,300,388 (GRCm39) T855M probably benign Het
Igf1r T A 7: 67,861,828 (GRCm39) N1129K probably damaging Het
Iglon5 T C 7: 43,130,062 (GRCm39) E34G probably damaging Het
Itprid1 A T 6: 55,874,797 (GRCm39) H249L possibly damaging Het
Kcnab1 T A 3: 65,226,888 (GRCm39) V189D probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lrrc49 A T 9: 60,505,440 (GRCm39) F538L possibly damaging Het
Ly6h A G 15: 75,437,038 (GRCm39) S113P probably benign Het
Mto1 A C 9: 78,364,846 (GRCm39) T362P possibly damaging Het
Myot A G 18: 44,487,339 (GRCm39) D392G probably damaging Het
Or10a3 A G 7: 108,480,172 (GRCm39) F214L probably benign Het
Or6z5 T C 7: 6,477,441 (GRCm39) S111P possibly damaging Het
Osbpl6 T C 2: 76,417,113 (GRCm39) F577L probably damaging Het
Otc A G X: 10,169,606 (GRCm39) Q216R probably benign Het
Pds5a A T 5: 65,811,441 (GRCm39) F331I probably damaging Het
Pld3 G A 7: 27,240,532 (GRCm39) T136M probably benign Het
Racgap1 A G 15: 99,524,417 (GRCm39) S357P probably benign Het
Ralgapa1 A T 12: 55,763,856 (GRCm39) H1403Q probably benign Het
Rnf216 G A 5: 143,076,681 (GRCm39) H68Y probably benign Het
Scgb1b27 T C 7: 33,721,249 (GRCm39) Y46H probably damaging Het
Sel1l2 T C 2: 140,086,085 (GRCm39) Y502C probably damaging Het
Sis A T 3: 72,820,527 (GRCm39) F1412L probably benign Het
Slc4a11 T C 2: 130,527,544 (GRCm39) E617G probably benign Het
Smap1 T C 1: 23,898,139 (GRCm39) N99S probably benign Het
Smg7 A T 1: 152,744,064 (GRCm39) Y40N probably damaging Het
Sox4 C T 13: 29,136,613 (GRCm39) R131Q probably damaging Het
Spaca6 T C 17: 18,058,507 (GRCm39) probably null Het
Tbx18 G T 9: 87,606,403 (GRCm39) S247R probably damaging Het
Tenm3 T C 8: 48,729,204 (GRCm39) I1601V probably benign Het
Thap4 G T 1: 93,652,934 (GRCm39) Q441K probably benign Het
Tmprss11c G T 5: 86,429,945 (GRCm39) T40K probably benign Het
Tpr T A 1: 150,317,843 (GRCm39) F2117Y probably benign Het
Traf5 T C 1: 191,738,806 (GRCm39) M125V probably damaging Het
Trim65 G T 11: 116,021,503 (GRCm39) T110K possibly damaging Het
Ubp1 T G 9: 113,793,712 (GRCm39) S340R probably damaging Het
Vit T C 17: 78,912,867 (GRCm39) S267P probably benign Het
Vmn2r124 A T 17: 18,269,927 (GRCm39) H61L possibly damaging Het
Zfp990 T A 4: 145,264,461 (GRCm39) H486Q probably damaging Het
Zkscan6 T C 11: 65,719,098 (GRCm39) S373P probably benign Het
Other mutations in Prph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Prph2 APN 17 47,230,704 (GRCm39) missense probably damaging 0.97
IGL01087:Prph2 APN 17 47,222,085 (GRCm39) missense probably damaging 0.97
PIT4480001:Prph2 UTSW 17 47,222,039 (GRCm39) frame shift probably null
R0025:Prph2 UTSW 17 47,230,697 (GRCm39) missense probably benign 0.17
R3120:Prph2 UTSW 17 47,234,298 (GRCm39) missense possibly damaging 0.49
R3954:Prph2 UTSW 17 47,221,644 (GRCm39) missense probably benign 0.39
R4864:Prph2 UTSW 17 47,221,848 (GRCm39) missense probably benign 0.03
R4972:Prph2 UTSW 17 47,221,733 (GRCm39) missense possibly damaging 0.94
R5645:Prph2 UTSW 17 47,221,593 (GRCm39) start gained probably benign
R5687:Prph2 UTSW 17 47,234,391 (GRCm39) missense probably damaging 0.99
R6494:Prph2 UTSW 17 47,222,007 (GRCm39) missense probably benign 0.03
R6658:Prph2 UTSW 17 47,230,790 (GRCm39) missense probably benign 0.05
R7775:Prph2 UTSW 17 47,221,732 (GRCm39) missense possibly damaging 0.82
R7778:Prph2 UTSW 17 47,221,732 (GRCm39) missense possibly damaging 0.82
R7824:Prph2 UTSW 17 47,221,732 (GRCm39) missense possibly damaging 0.82
R8098:Prph2 UTSW 17 47,230,892 (GRCm39) missense probably benign 0.09
R9221:Prph2 UTSW 17 47,230,818 (GRCm39) missense probably damaging 1.00
R9703:Prph2 UTSW 17 47,234,447 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGTACGCCAAGTGGAAGC -3'
(R):5'- CCAGACATCCGTTCTATACTCAGTAG -3'

Sequencing Primer
(F):5'- CAAGTGGAAGCCCTGGC -3'
(R):5'- CCGTTCTATACTCAGTAGAGGGAAAG -3'
Posted On 2014-10-15