Incidental Mutation 'R2237:Pex1'
ID240436
Institutional Source Beutler Lab
Gene Symbol Pex1
Ensembl Gene ENSMUSG00000005907
Gene Nameperoxisomal biogenesis factor 1
Synonymsperoxisome biogenesis factor 1, ZWS1
MMRRC Submission 040237-MU
Accession Numbers

Genbank: NM_027777

Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R2237 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3596066-3637232 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 3618915 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000121291] [ENSMUST00000143132] [ENSMUST00000195894]
Predicted Effect probably null
Transcript: ENSMUST00000006061
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121291
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126545
SMART Domains Protein: ENSMUSP00000121813
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
low complexity region 88 107 N/A INTRINSIC
Pfam:AAA 136 212 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143132
SMART Domains Protein: ENSMUSP00000116645
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Blast:AAA 1 68 7e-31 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143959
Predicted Effect probably benign
Transcript: ENSMUST00000195894
SMART Domains Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,160 M313K possibly damaging Het
4931409K22Rik A T 5: 24,548,294 N453K probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Alox8 A C 11: 69,185,771 S572A probably benign Het
Aoah G A 13: 20,794,311 probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arhgef37 T A 18: 61,504,406 Y395F probably damaging Het
Bard1 G A 1: 71,074,976 P282L probably damaging Het
Brd7 T A 8: 88,346,913 E283V probably benign Het
Btbd9 T C 17: 30,334,328 I387V probably benign Het
Cacna1a T C 8: 84,633,765 probably null Het
Cacna1c T C 6: 118,652,743 Q1205R possibly damaging Het
Camsap2 A T 1: 136,345,331 L36Q probably damaging Het
Ccnj T C 19: 40,845,775 F261L probably benign Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdca7l A G 12: 117,874,026 E237G probably damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Clhc1 T G 11: 29,569,329 S379A probably benign Het
Dbf4 T A 5: 8,408,542 I158L possibly damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dlec1 T C 9: 119,138,191 probably null Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Espl1 G A 15: 102,315,569 R1185H probably damaging Het
Evc2 T C 5: 37,378,183 S401P probably benign Het
Fbxw15 A G 9: 109,555,235 S403P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Hsd17b1 G A 11: 101,079,826 V236M probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Itpripl2 T C 7: 118,490,071 T422A probably benign Het
Izumo4 T C 10: 80,702,830 S39P probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kctd8 T A 5: 69,110,409 I453F probably damaging Het
Kif5c A G 2: 49,694,008 T152A probably benign Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
L3mbtl2 A T 15: 81,684,330 T512S probably benign Het
Ltbp1 C A 17: 75,310,163 D1032E probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Muc5b T G 7: 141,862,089 I2924S probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nid1 T C 13: 13,500,485 V930A probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5m A G 11: 59,852,870 K108R probably benign Het
Olfr1341 A G 4: 118,709,995 D196G probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Osbpl9 T A 4: 109,156,657 Q80L probably damaging Het
Osm A G 11: 4,238,505 N44S possibly damaging Het
Pclo C T 5: 14,713,938 P4142S unknown Het
Pdlim2 T G 14: 70,171,249 T173P probably benign Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Plscr2 T C 9: 92,290,824 C179R probably damaging Het
Rbpms2 C A 9: 65,651,611 Y183* probably null Het
Ryr2 T A 13: 11,662,260 E3235V probably benign Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Siglecf T C 7: 43,354,985 V246A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tas1r3 A T 4: 155,862,218 M310K possibly damaging Het
Tenm3 G A 8: 48,342,337 P585L probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Ttll2 G A 17: 7,352,123 T135I probably benign Het
Ubr4 A G 4: 139,442,790 S1584G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r80 G A 10: 79,168,270 E106K probably damaging Het
Xpc T C 6: 91,498,108 H643R probably damaging Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Pex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Pex1 APN 5 3606027 missense probably benign 0.00
IGL01315:Pex1 APN 5 3609975 missense probably damaging 1.00
IGL01671:Pex1 APN 5 3624088 missense probably benign 0.00
IGL01863:Pex1 APN 5 3606066 missense probably benign 0.01
IGL01933:Pex1 APN 5 3633789 missense probably damaging 1.00
IGL01960:Pex1 APN 5 3627588 unclassified probably benign
IGL02347:Pex1 APN 5 3603350 missense probably damaging 0.98
IGL02374:Pex1 APN 5 3635481 missense probably benign 0.01
IGL02392:Pex1 APN 5 3605952 nonsense probably null
IGL02597:Pex1 APN 5 3635865 missense possibly damaging 0.50
IGL02703:Pex1 APN 5 3615120 missense probably benign 0.24
IGL02815:Pex1 APN 5 3636797 missense probably damaging 0.97
IGL02862:Pex1 APN 5 3605424 intron probably benign
IGL03005:Pex1 APN 5 3630292 missense probably null 0.96
E0370:Pex1 UTSW 5 3631614 unclassified probably null
F5493:Pex1 UTSW 5 3635912 critical splice donor site probably null
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0401:Pex1 UTSW 5 3633759 missense probably damaging 1.00
R0480:Pex1 UTSW 5 3606444 intron probably null
R0555:Pex1 UTSW 5 3606130 missense possibly damaging 0.89
R0976:Pex1 UTSW 5 3633943 missense probably benign 0.00
R1200:Pex1 UTSW 5 3606411 critical splice donor site probably null
R1672:Pex1 UTSW 5 3626085 missense probably damaging 1.00
R1753:Pex1 UTSW 5 3630044 missense probably damaging 1.00
R1880:Pex1 UTSW 5 3605770 missense probably benign
R1953:Pex1 UTSW 5 3630038 missense probably damaging 1.00
R2054:Pex1 UTSW 5 3603341 missense possibly damaging 0.78
R2081:Pex1 UTSW 5 3624132 critical splice donor site probably null
R3946:Pex1 UTSW 5 3626084 missense probably damaging 1.00
R4528:Pex1 UTSW 5 3631712 missense probably damaging 1.00
R4579:Pex1 UTSW 5 3618880 missense probably benign 0.03
R4585:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4586:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4656:Pex1 UTSW 5 3604880 critical splice donor site probably null
R4789:Pex1 UTSW 5 3630270 missense probably damaging 0.98
R4850:Pex1 UTSW 5 3624426 missense probably benign
R4963:Pex1 UTSW 5 3609924 missense probably benign 0.01
R5005:Pex1 UTSW 5 3622310 missense probably damaging 1.00
R5015:Pex1 UTSW 5 3620597 missense probably damaging 1.00
R5019:Pex1 UTSW 5 3622331 missense probably damaging 1.00
R5937:Pex1 UTSW 5 3624487 missense possibly damaging 0.94
R5942:Pex1 UTSW 5 3610277 missense probably benign 0.04
R5995:Pex1 UTSW 5 3607704 missense possibly damaging 0.53
R6434:Pex1 UTSW 5 3630196 nonsense probably null
R6552:Pex1 UTSW 5 3623953 missense probably damaging 1.00
R6777:Pex1 UTSW 5 3622358 missense probably benign 0.01
R6877:Pex1 UTSW 5 3635505 missense probably benign 0.19
R6948:Pex1 UTSW 5 3605994 missense probably benign 0.00
X0019:Pex1 UTSW 5 3605653 missense probably damaging 1.00
X0027:Pex1 UTSW 5 3630270 missense probably damaging 0.98
Z1088:Pex1 UTSW 5 3606075 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAATCTTGGAGGCTGCTGC -3'
(R):5'- GCAAGTGTGGTATTTCTACAGAGC -3'

Sequencing Primer
(F):5'- GAGGCTGCTGCAGTGGC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2014-10-15