Incidental Mutation 'R2237:Tenm3'
ID240459
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 040237-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R2237 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48342337 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 585 (P585L)
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110346] [ENSMUST00000190840]
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: P585L

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: P585L

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110346
AA Change: P313L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561
AA Change: P313L

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: P585L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: P585L

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,160 M313K possibly damaging Het
4931409K22Rik A T 5: 24,548,294 N453K probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Alox8 A C 11: 69,185,771 S572A probably benign Het
Aoah G A 13: 20,794,311 probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arhgef37 T A 18: 61,504,406 Y395F probably damaging Het
Bard1 G A 1: 71,074,976 P282L probably damaging Het
Brd7 T A 8: 88,346,913 E283V probably benign Het
Btbd9 T C 17: 30,334,328 I387V probably benign Het
Cacna1a T C 8: 84,633,765 probably null Het
Cacna1c T C 6: 118,652,743 Q1205R possibly damaging Het
Camsap2 A T 1: 136,345,331 L36Q probably damaging Het
Ccnj T C 19: 40,845,775 F261L probably benign Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdca7l A G 12: 117,874,026 E237G probably damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Clhc1 T G 11: 29,569,329 S379A probably benign Het
Dbf4 T A 5: 8,408,542 I158L possibly damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dlec1 T C 9: 119,138,191 probably null Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Espl1 G A 15: 102,315,569 R1185H probably damaging Het
Evc2 T C 5: 37,378,183 S401P probably benign Het
Fbxw15 A G 9: 109,555,235 S403P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Hsd17b1 G A 11: 101,079,826 V236M probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Itpripl2 T C 7: 118,490,071 T422A probably benign Het
Izumo4 T C 10: 80,702,830 S39P probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kctd8 T A 5: 69,110,409 I453F probably damaging Het
Kif5c A G 2: 49,694,008 T152A probably benign Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
L3mbtl2 A T 15: 81,684,330 T512S probably benign Het
Ltbp1 C A 17: 75,310,163 D1032E probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Muc5b T G 7: 141,862,089 I2924S probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nid1 T C 13: 13,500,485 V930A probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5m A G 11: 59,852,870 K108R probably benign Het
Olfr1341 A G 4: 118,709,995 D196G probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Osbpl9 T A 4: 109,156,657 Q80L probably damaging Het
Osm A G 11: 4,238,505 N44S possibly damaging Het
Pclo C T 5: 14,713,938 P4142S unknown Het
Pdlim2 T G 14: 70,171,249 T173P probably benign Het
Pex1 T C 5: 3,618,915 probably null Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Plscr2 T C 9: 92,290,824 C179R probably damaging Het
Rbpms2 C A 9: 65,651,611 Y183* probably null Het
Ryr2 T A 13: 11,662,260 E3235V probably benign Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Siglecf T C 7: 43,354,985 V246A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tas1r3 A T 4: 155,862,218 M310K possibly damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Ttll2 G A 17: 7,352,123 T135I probably benign Het
Ubr4 A G 4: 139,442,790 S1584G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r80 G A 10: 79,168,270 E106K probably damaging Het
Xpc T C 6: 91,498,108 H643R probably damaging Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense not run
R7140:Tenm3 UTSW 8 48292236 missense not run
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTAAGATGCCTTTGCCC -3'
(R):5'- CTGAGAATGCATAGCAACGC -3'

Sequencing Primer
(F):5'- ATGCCTTTGCCCAATGGAAG -3'
(R):5'- TGCATAGCAACGCGGCAAAG -3'
Posted On2014-10-15