Incidental Mutation 'R2237:Eomes'
ID240473
Institutional Source Beutler Lab
Gene Symbol Eomes
Ensembl Gene ENSMUSG00000032446
Gene Nameeomesodermin
SynonymsTbr2
MMRRC Submission 040237-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2237 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location118478212-118486132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118482291 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000118079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035020] [ENSMUST00000111763] [ENSMUST00000150633]
Predicted Effect probably damaging
Transcript: ENSMUST00000035020
AA Change: D461G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035020
Gene: ENSMUSG00000032446
AA Change: D461G

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 7.3e-120 SMART
Pfam:T-box_assoc 484 705 1.6e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111763
AA Change: D461G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107393
Gene: ENSMUSG00000032446
AA Change: D461G

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 5.53e-120 SMART
Blast:TBOX 485 511 6e-8 BLAST
low complexity region 648 659 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150633
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118079
Gene: ENSMUSG00000032446
AA Change: D394G

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 60 67 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
TBOX 201 395 8.01e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212286
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to implant, and lack trophoectoderm outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,160 M313K possibly damaging Het
4931409K22Rik A T 5: 24,548,294 N453K probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Alox8 A C 11: 69,185,771 S572A probably benign Het
Aoah G A 13: 20,794,311 probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arhgef37 T A 18: 61,504,406 Y395F probably damaging Het
Bard1 G A 1: 71,074,976 P282L probably damaging Het
Brd7 T A 8: 88,346,913 E283V probably benign Het
Btbd9 T C 17: 30,334,328 I387V probably benign Het
Cacna1a T C 8: 84,633,765 probably null Het
Cacna1c T C 6: 118,652,743 Q1205R possibly damaging Het
Camsap2 A T 1: 136,345,331 L36Q probably damaging Het
Ccnj T C 19: 40,845,775 F261L probably benign Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdca7l A G 12: 117,874,026 E237G probably damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Clhc1 T G 11: 29,569,329 S379A probably benign Het
Dbf4 T A 5: 8,408,542 I158L possibly damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dlec1 T C 9: 119,138,191 probably null Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Espl1 G A 15: 102,315,569 R1185H probably damaging Het
Evc2 T C 5: 37,378,183 S401P probably benign Het
Fbxw15 A G 9: 109,555,235 S403P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Hsd17b1 G A 11: 101,079,826 V236M probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Itpripl2 T C 7: 118,490,071 T422A probably benign Het
Izumo4 T C 10: 80,702,830 S39P probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kctd8 T A 5: 69,110,409 I453F probably damaging Het
Kif5c A G 2: 49,694,008 T152A probably benign Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
L3mbtl2 A T 15: 81,684,330 T512S probably benign Het
Ltbp1 C A 17: 75,310,163 D1032E probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Muc5b T G 7: 141,862,089 I2924S probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nid1 T C 13: 13,500,485 V930A probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5m A G 11: 59,852,870 K108R probably benign Het
Olfr1341 A G 4: 118,709,995 D196G probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Osbpl9 T A 4: 109,156,657 Q80L probably damaging Het
Osm A G 11: 4,238,505 N44S possibly damaging Het
Pclo C T 5: 14,713,938 P4142S unknown Het
Pdlim2 T G 14: 70,171,249 T173P probably benign Het
Pex1 T C 5: 3,618,915 probably null Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Plscr2 T C 9: 92,290,824 C179R probably damaging Het
Rbpms2 C A 9: 65,651,611 Y183* probably null Het
Ryr2 T A 13: 11,662,260 E3235V probably benign Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Siglecf T C 7: 43,354,985 V246A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tas1r3 A T 4: 155,862,218 M310K possibly damaging Het
Tenm3 G A 8: 48,342,337 P585L probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Ttll2 G A 17: 7,352,123 T135I probably benign Het
Ubr4 A G 4: 139,442,790 S1584G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r80 G A 10: 79,168,270 E106K probably damaging Het
Xpc T C 6: 91,498,108 H643R probably damaging Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Eomes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Eomes APN 9 118482266 missense probably damaging 1.00
IGL01322:Eomes APN 9 118484830 missense probably benign 0.14
IGL01532:Eomes APN 9 118482249 missense probably damaging 1.00
R0088:Eomes UTSW 9 118478673 missense probably damaging 0.99
R0305:Eomes UTSW 9 118484757 missense probably benign 0.11
R0894:Eomes UTSW 9 118482300 splice site probably null
R1110:Eomes UTSW 9 118484599 missense probably benign 0.29
R1326:Eomes UTSW 9 118484497 nonsense probably null
R1942:Eomes UTSW 9 118484648 missense probably benign 0.01
R2108:Eomes UTSW 9 118478852 missense probably benign 0.09
R2238:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2239:Eomes UTSW 9 118482291 missense probably damaging 1.00
R3915:Eomes UTSW 9 118481273 missense probably benign 0.01
R4158:Eomes UTSW 9 118478963 missense probably benign
R5274:Eomes UTSW 9 118480529 missense probably damaging 1.00
R6894:Eomes UTSW 9 118481285 missense probably damaging 1.00
R7055:Eomes UTSW 9 118480499 missense possibly damaging 0.57
R7115:Eomes UTSW 9 118484489 missense not run
X0021:Eomes UTSW 9 118482258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTCATCGCTGTGACG -3'
(R):5'- GGCTCGAAGATGAAACTCCATTG -3'

Sequencing Primer
(F):5'- GGCCTACCAAAACACGGATGTG -3'
(R):5'- GATTGTCTAGCTCACACAAAGCCTG -3'
Posted On2014-10-15