Incidental Mutation 'R2237:Dlec1'
ID240474
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission 040237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2237 (G1)
Quality Score183
Status Not validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 119138191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect probably benign
Transcript: ENSMUST00000055775
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect probably null
Transcript: ENSMUST00000140326
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165231
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,160 M313K possibly damaging Het
4931409K22Rik A T 5: 24,548,294 N453K probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Alox8 A C 11: 69,185,771 S572A probably benign Het
Aoah G A 13: 20,794,311 probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arhgef37 T A 18: 61,504,406 Y395F probably damaging Het
Bard1 G A 1: 71,074,976 P282L probably damaging Het
Brd7 T A 8: 88,346,913 E283V probably benign Het
Btbd9 T C 17: 30,334,328 I387V probably benign Het
Cacna1a T C 8: 84,633,765 probably null Het
Cacna1c T C 6: 118,652,743 Q1205R possibly damaging Het
Camsap2 A T 1: 136,345,331 L36Q probably damaging Het
Ccnj T C 19: 40,845,775 F261L probably benign Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdca7l A G 12: 117,874,026 E237G probably damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Clhc1 T G 11: 29,569,329 S379A probably benign Het
Dbf4 T A 5: 8,408,542 I158L possibly damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Espl1 G A 15: 102,315,569 R1185H probably damaging Het
Evc2 T C 5: 37,378,183 S401P probably benign Het
Fbxw15 A G 9: 109,555,235 S403P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Hsd17b1 G A 11: 101,079,826 V236M probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Itpripl2 T C 7: 118,490,071 T422A probably benign Het
Izumo4 T C 10: 80,702,830 S39P probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kctd8 T A 5: 69,110,409 I453F probably damaging Het
Kif5c A G 2: 49,694,008 T152A probably benign Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
L3mbtl2 A T 15: 81,684,330 T512S probably benign Het
Ltbp1 C A 17: 75,310,163 D1032E probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Muc5b T G 7: 141,862,089 I2924S probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nid1 T C 13: 13,500,485 V930A probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5m A G 11: 59,852,870 K108R probably benign Het
Olfr1341 A G 4: 118,709,995 D196G probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Osbpl9 T A 4: 109,156,657 Q80L probably damaging Het
Osm A G 11: 4,238,505 N44S possibly damaging Het
Pclo C T 5: 14,713,938 P4142S unknown Het
Pdlim2 T G 14: 70,171,249 T173P probably benign Het
Pex1 T C 5: 3,618,915 probably null Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Plscr2 T C 9: 92,290,824 C179R probably damaging Het
Rbpms2 C A 9: 65,651,611 Y183* probably null Het
Ryr2 T A 13: 11,662,260 E3235V probably benign Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Siglecf T C 7: 43,354,985 V246A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tas1r3 A T 4: 155,862,218 M310K possibly damaging Het
Tenm3 G A 8: 48,342,337 P585L probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Ttll2 G A 17: 7,352,123 T135I probably benign Het
Ubr4 A G 4: 139,442,790 S1584G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r80 G A 10: 79,168,270 E106K probably damaging Het
Xpc T C 6: 91,498,108 H643R probably damaging Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAGCCTTACTAACCCTTGGG -3'
(R):5'- AGATCCAGAAGGCTCTGCTAC -3'

Sequencing Primer
(F):5'- TGGGGATTTCAGCCCTCAC -3'
(R):5'- CCAGAAGGCTCTGCTACACAGG -3'
Posted On2014-10-15