Incidental Mutation 'R0164:Unc13c'
ID24048
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R0164 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73694892 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1357 (I1357M)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably benign
Transcript: ENSMUST00000075245
AA Change: I1357M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: I1357M

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
AA Change: I1357M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: I1357M

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf1 T A 9: 106,844,145 S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Klc3 T A 7: 19,394,926 N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tcp1 T A 17: 12,922,747 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 P631S possibly damaging Het
Tomm70a T C 16: 57,147,821 V517A probably damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Ulk3 T A 9: 57,590,686 I90N probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTCGTGTACAGCAAGGAACAGACAG -3'
(R):5'- AGCCTCACTTGGCCCAATCTTTATG -3'

Sequencing Primer
(F):5'- ATTCTGAATTCCCACTGAAGGGC -3'
(R):5'- CCCAATCTTTATGGTTGTGGTGAG -3'
Posted On2013-04-16