Incidental Mutation 'R2237:L3mbtl2'
ID240495
Institutional Source Beutler Lab
Gene Symbol L3mbtl2
Ensembl Gene ENSMUSG00000022394
Gene NameL3MBTL2 polycomb repressive complex 1 subunit
Synonymsm4mbt, 4732493N06Rik
MMRRC Submission 040237-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R2237 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81663889-81688315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81684330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 512 (T512S)
Ref Sequence ENSEMBL: ENSMUSP00000133967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023029] [ENSMUST00000072910] [ENSMUST00000172568] [ENSMUST00000172748] [ENSMUST00000173598] [ENSMUST00000174229]
Predicted Effect probably benign
Transcript: ENSMUST00000023029
AA Change: T512S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023029
Gene: ENSMUSG00000022394
AA Change: T512S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 6e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072910
SMART Domains Protein: ENSMUSP00000072682
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
LRRNT 31 65 3.72e-4 SMART
LRR 59 83 1e1 SMART
LRR_TYP 84 107 7.78e-3 SMART
LRR_TYP 108 131 5.81e-2 SMART
LRR_TYP 132 155 3.89e-3 SMART
LRR_TYP 156 179 6.42e-4 SMART
LRR 180 203 1.37e1 SMART
LRR_TYP 204 227 5.5e-3 SMART
LRR 252 275 3.24e0 SMART
LRR 276 299 2.92e1 SMART
LRRCT 309 357 3.81e-2 SMART
low complexity region 358 372 N/A INTRINSIC
LRRNT 394 428 1.51e-4 SMART
LRR 427 446 1.26e2 SMART
LRR 447 470 3.97e0 SMART
LRR 471 494 1.08e-1 SMART
LRR 496 518 6.23e1 SMART
LRR 519 542 9.48e0 SMART
LRR 544 566 6.96e0 SMART
LRR 568 590 1.14e0 SMART
LRR_TYP 591 614 7.09e-6 SMART
LRR 617 639 3.76e1 SMART
LRR 640 665 6.59e1 SMART
LRRCT 674 722 2.87e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172620
Predicted Effect probably benign
Transcript: ENSMUST00000172748
AA Change: T512S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134333
Gene: ENSMUSG00000022394
AA Change: T512S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 1e-13 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173598
SMART Domains Protein: ENSMUSP00000133834
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 5 28 1.08e-1 SMART
LRR 30 52 6.23e1 SMART
LRR 53 76 9.48e0 SMART
LRR 78 100 6.96e0 SMART
LRR 102 124 1.14e0 SMART
LRR_TYP 125 148 7.09e-6 SMART
LRR 151 173 3.76e1 SMART
LRR 174 199 6.59e1 SMART
LRRCT 208 256 2.87e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173761
Predicted Effect probably benign
Transcript: ENSMUST00000173898
SMART Domains Protein: ENSMUSP00000133981
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 21 40 1.26e2 SMART
LRR 41 64 3.97e0 SMART
LRR 65 88 1.08e-1 SMART
LRR 90 112 6.23e1 SMART
LRR 113 136 9.48e0 SMART
LRR 138 160 6.96e0 SMART
LRR 162 184 1.14e0 SMART
LRR_TYP 185 208 7.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174229
AA Change: T512S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133967
Gene: ENSMUSG00000022394
AA Change: T512S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 8e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174401
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure of the inner cell mass to form a normal primitive ectoderm capable of gastrulation leading to abnormal embryo development, embryonic growth arrest, and lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,160 M313K possibly damaging Het
4931409K22Rik A T 5: 24,548,294 N453K probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Alox8 A C 11: 69,185,771 S572A probably benign Het
Aoah G A 13: 20,794,311 probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arhgef37 T A 18: 61,504,406 Y395F probably damaging Het
Bard1 G A 1: 71,074,976 P282L probably damaging Het
Brd7 T A 8: 88,346,913 E283V probably benign Het
Btbd9 T C 17: 30,334,328 I387V probably benign Het
Cacna1a T C 8: 84,633,765 probably null Het
Cacna1c T C 6: 118,652,743 Q1205R possibly damaging Het
Camsap2 A T 1: 136,345,331 L36Q probably damaging Het
Ccnj T C 19: 40,845,775 F261L probably benign Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdca7l A G 12: 117,874,026 E237G probably damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Clhc1 T G 11: 29,569,329 S379A probably benign Het
Dbf4 T A 5: 8,408,542 I158L possibly damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dlec1 T C 9: 119,138,191 probably null Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Espl1 G A 15: 102,315,569 R1185H probably damaging Het
Evc2 T C 5: 37,378,183 S401P probably benign Het
Fbxw15 A G 9: 109,555,235 S403P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Hsd17b1 G A 11: 101,079,826 V236M probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Itpripl2 T C 7: 118,490,071 T422A probably benign Het
Izumo4 T C 10: 80,702,830 S39P probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kctd8 T A 5: 69,110,409 I453F probably damaging Het
Kif5c A G 2: 49,694,008 T152A probably benign Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Ltbp1 C A 17: 75,310,163 D1032E probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Muc5b T G 7: 141,862,089 I2924S probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nid1 T C 13: 13,500,485 V930A probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5m A G 11: 59,852,870 K108R probably benign Het
Olfr1341 A G 4: 118,709,995 D196G probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Osbpl9 T A 4: 109,156,657 Q80L probably damaging Het
Osm A G 11: 4,238,505 N44S possibly damaging Het
Pclo C T 5: 14,713,938 P4142S unknown Het
Pdlim2 T G 14: 70,171,249 T173P probably benign Het
Pex1 T C 5: 3,618,915 probably null Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Plscr2 T C 9: 92,290,824 C179R probably damaging Het
Rbpms2 C A 9: 65,651,611 Y183* probably null Het
Ryr2 T A 13: 11,662,260 E3235V probably benign Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Siglecf T C 7: 43,354,985 V246A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tas1r3 A T 4: 155,862,218 M310K possibly damaging Het
Tenm3 G A 8: 48,342,337 P585L probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Ttll2 G A 17: 7,352,123 T135I probably benign Het
Ubr4 A G 4: 139,442,790 S1584G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r80 G A 10: 79,168,270 E106K probably damaging Het
Xpc T C 6: 91,498,108 H643R probably damaging Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in L3mbtl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:L3mbtl2 APN 15 81684898 missense possibly damaging 0.89
IGL01380:L3mbtl2 APN 15 81671125 missense possibly damaging 0.75
IGL01479:L3mbtl2 APN 15 81676392 missense probably benign 0.05
IGL02943:L3mbtl2 APN 15 81686255 missense possibly damaging 0.56
IGL03406:L3mbtl2 APN 15 81681993 missense probably damaging 1.00
R0393:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0394:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0449:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0565:L3mbtl2 UTSW 15 81684286 splice site probably benign
R1263:L3mbtl2 UTSW 15 81682968 missense probably benign 0.00
R1426:L3mbtl2 UTSW 15 81676317 missense possibly damaging 0.95
R1542:L3mbtl2 UTSW 15 81682151 missense probably null 0.45
R1556:L3mbtl2 UTSW 15 81682002 missense probably benign 0.23
R1922:L3mbtl2 UTSW 15 81675621 missense probably damaging 1.00
R2135:L3mbtl2 UTSW 15 81682014 missense possibly damaging 0.94
R4112:L3mbtl2 UTSW 15 81681969 missense possibly damaging 0.90
R4577:L3mbtl2 UTSW 15 81686285 missense probably benign
R4583:L3mbtl2 UTSW 15 81684906 missense probably damaging 1.00
R4779:L3mbtl2 UTSW 15 81682612 missense probably benign
R4787:L3mbtl2 UTSW 15 81663974 utr 5 prime probably benign
R5448:L3mbtl2 UTSW 15 81684333 missense possibly damaging 0.93
R5776:L3mbtl2 UTSW 15 81684871 missense probably damaging 1.00
R6019:L3mbtl2 UTSW 15 81686942 missense probably benign 0.00
R6058:L3mbtl2 UTSW 15 81667354 missense probably benign
R6259:L3mbtl2 UTSW 15 81681927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTGTGTTAGGGCCATC -3'
(R):5'- GTCCAGCAAGTATCCACATTAACAG -3'

Sequencing Primer
(F):5'- TGTTAGGGCCATCCAGGAG -3'
(R):5'- CCACATTAACAGTTTTCTAGAAGCCG -3'
Posted On2014-10-15