Incidental Mutation 'R2237:Olfr1417'
ID240505
Institutional Source Beutler Lab
Gene Symbol Olfr1417
Ensembl Gene ENSMUSG00000048292
Gene Nameolfactory receptor 1417
SynonymsGA_x6K02T2RE5P-2172809-2171862, MOR266-2
MMRRC Submission 040237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2237 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11826803-11839219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11828450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000149141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061235] [ENSMUST00000214887]
Predicted Effect probably damaging
Transcript: ENSMUST00000061235
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062542
Gene: ENSMUSG00000048292
AA Change: D192G

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.3e-53 PFAM
Pfam:7tm_1 41 291 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213141
Predicted Effect probably damaging
Transcript: ENSMUST00000214887
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,160 M313K possibly damaging Het
4931409K22Rik A T 5: 24,548,294 N453K probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Alox8 A C 11: 69,185,771 S572A probably benign Het
Aoah G A 13: 20,794,311 probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arhgef37 T A 18: 61,504,406 Y395F probably damaging Het
Bard1 G A 1: 71,074,976 P282L probably damaging Het
Brd7 T A 8: 88,346,913 E283V probably benign Het
Btbd9 T C 17: 30,334,328 I387V probably benign Het
Cacna1a T C 8: 84,633,765 probably null Het
Cacna1c T C 6: 118,652,743 Q1205R possibly damaging Het
Camsap2 A T 1: 136,345,331 L36Q probably damaging Het
Ccnj T C 19: 40,845,775 F261L probably benign Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdca7l A G 12: 117,874,026 E237G probably damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Clhc1 T G 11: 29,569,329 S379A probably benign Het
Dbf4 T A 5: 8,408,542 I158L possibly damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dlec1 T C 9: 119,138,191 probably null Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Espl1 G A 15: 102,315,569 R1185H probably damaging Het
Evc2 T C 5: 37,378,183 S401P probably benign Het
Fbxw15 A G 9: 109,555,235 S403P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Hsd17b1 G A 11: 101,079,826 V236M probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Itpripl2 T C 7: 118,490,071 T422A probably benign Het
Izumo4 T C 10: 80,702,830 S39P probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kctd8 T A 5: 69,110,409 I453F probably damaging Het
Kif5c A G 2: 49,694,008 T152A probably benign Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
L3mbtl2 A T 15: 81,684,330 T512S probably benign Het
Ltbp1 C A 17: 75,310,163 D1032E probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Muc5b T G 7: 141,862,089 I2924S probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nid1 T C 13: 13,500,485 V930A probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5m A G 11: 59,852,870 K108R probably benign Het
Olfr1341 A G 4: 118,709,995 D196G probably damaging Het
Osbpl9 T A 4: 109,156,657 Q80L probably damaging Het
Osm A G 11: 4,238,505 N44S possibly damaging Het
Pclo C T 5: 14,713,938 P4142S unknown Het
Pdlim2 T G 14: 70,171,249 T173P probably benign Het
Pex1 T C 5: 3,618,915 probably null Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Plscr2 T C 9: 92,290,824 C179R probably damaging Het
Rbpms2 C A 9: 65,651,611 Y183* probably null Het
Ryr2 T A 13: 11,662,260 E3235V probably benign Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Siglecf T C 7: 43,354,985 V246A probably benign Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tas1r3 A T 4: 155,862,218 M310K possibly damaging Het
Tenm3 G A 8: 48,342,337 P585L probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Ttll2 G A 17: 7,352,123 T135I probably benign Het
Ubr4 A G 4: 139,442,790 S1584G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r80 G A 10: 79,168,270 E106K probably damaging Het
Xpc T C 6: 91,498,108 H643R probably damaging Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Olfr1417
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0530:Olfr1417 UTSW 19 11828192 missense probably benign 0.26
R1532:Olfr1417 UTSW 19 11828619 missense probably benign 0.00
R1730:Olfr1417 UTSW 19 11828081 missense probably benign 0.06
R2032:Olfr1417 UTSW 19 11828300 missense probably damaging 1.00
R2238:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2239:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R4959:Olfr1417 UTSW 19 11828936 missense probably benign
R4973:Olfr1417 UTSW 19 11828936 missense probably benign
R5015:Olfr1417 UTSW 19 11828118 missense probably benign 0.00
R6799:Olfr1417 UTSW 19 11828814 missense possibly damaging 0.91
R6984:Olfr1417 UTSW 19 11828304 missense probably damaging 1.00
R7063:Olfr1417 UTSW 19 11828184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATACTGCAGGAGGACAAC -3'
(R):5'- ATGACCGGTTTGTGGCCATC -3'

Sequencing Primer
(F):5'- CTGCAGGAGGACAACGGTCAG -3'
(R):5'- GCGCTATACCCTCATCATGAG -3'
Posted On2014-10-15