Incidental Mutation 'R2239:Ago3'
ID240526
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
MMRRC Submission 040239-MU
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R2239 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126368522 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 412 (R412C)
Ref Sequence ENSEMBL: ENSMUSP00000066633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097]
Predicted Effect probably damaging
Transcript: ENSMUST00000069097
AA Change: R412C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: R412C

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,646,287 E406G probably benign Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm T A 1: 139,456,846 I127K possibly damaging Het
Atp8b3 A G 10: 80,530,988 C259R probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Ccdc47 G T 11: 106,202,134 N100K possibly damaging Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Cnnm4 T A 1: 36,505,678 S673T probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Dars2 T C 1: 161,063,282 T120A possibly damaging Het
Dnah7b C A 1: 46,201,184 probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Exoc1 T C 5: 76,559,710 probably benign Het
Fam186a C T 15: 99,954,864 V158M unknown Het
Fryl A G 5: 73,108,547 L477P probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ift88 A G 14: 57,455,504 I387V probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Map3k1 A C 13: 111,748,944 S1480A probably benign Het
Map7 A T 10: 20,278,282 N715Y unknown Het
Morn4 A G 19: 42,078,032 Y39H possibly damaging Het
Myh14 A T 7: 44,665,183 D105E probably damaging Het
Nfasc T C 1: 132,583,022 probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr205 T A 16: 59,329,375 I45F probably damaging Het
Olfr223 A G 11: 59,589,271 S273P possibly damaging Het
P4hb A G 11: 120,563,282 Y329H probably damaging Het
Papolg A G 11: 23,876,378 Y259H probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Pde4a G A 9: 21,211,268 C820Y probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Phrf1 A G 7: 141,237,692 E138G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc16a8 T C 15: 79,252,947 M88V probably damaging Het
Slc35f4 A G 14: 49,306,203 probably null Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tet1 T C 10: 62,879,734 D94G probably benign Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,576,214 T2020K probably benign Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4272:Ago3 UTSW 4 126355091 missense possibly damaging 0.95
R4533:Ago3 UTSW 4 126345563 missense probably damaging 1.00
R4575:Ago3 UTSW 4 126346682 missense probably benign 0.06
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5180:Ago3 UTSW 4 126367751 missense probably benign 0.01
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126355050 missense probably damaging 1.00
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACTTAGAGTGCCATTCTCTCCC -3'
(R):5'- TCTCTGCCTTATGGTCAGGG -3'

Sequencing Primer
(F):5'- GAGTGCTCTGATGCATGTACACC -3'
(R):5'- CCTTATGGTCAGGGCACTG -3'
Posted On2014-10-15