Incidental Mutation 'R2244:Usp20'
ID240594
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Nameubiquitin specific peptidase 20
Synonyms1700055M05Rik, Vdu2
MMRRC Submission 040244-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2244 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30982279-31023586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31010331 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 286 (S286P)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102849
AA Change: S286P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: S286P

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136588
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154351
Predicted Effect possibly damaging
Transcript: ENSMUST00000170476
AA Change: S286P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: S286P

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A G 7: 132,883,211 T328A probably benign Het
Aen T C 7: 78,907,297 Y156H probably damaging Het
Aip T C 19: 4,114,796 D263G probably benign Het
Car1 T A 3: 14,770,852 I70F possibly damaging Het
Cc2d2a T A 5: 43,732,433 F1357Y probably damaging Het
Cit A G 5: 115,926,505 E482G probably damaging Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Fbxw24 T C 9: 109,605,049 T398A possibly damaging Het
Fpr3 T C 17: 17,971,187 F240S probably benign Het
Herc6 A T 6: 57,598,617 R208* probably null Het
Itsn1 A G 16: 91,853,771 N928S probably null Het
Ly75 T C 2: 60,349,913 D640G probably benign Het
Mfsd4a T A 1: 132,028,505 E507V probably benign Het
Nyap1 T C 5: 137,735,314 T486A probably damaging Het
Olfr744 G A 14: 50,618,657 C145Y probably damaging Het
Pgam2 T C 11: 5,801,723 T238A probably benign Het
Pgm1 A G 5: 64,106,702 D343G probably benign Het
Rbpjl G T 2: 164,403,217 probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Selp G T 1: 164,137,286 E506* probably null Het
Sgo2a T C 1: 58,017,054 I799T probably benign Het
Slc45a2 A G 15: 11,003,001 T187A probably benign Het
Tenm2 A T 11: 36,864,862 L103H probably damaging Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGACATGGTCCTGGTTGCAG -3'
(R):5'- GGATTGCTCATCAAGGGACG -3'

Sequencing Primer
(F):5'- TTGCAGGACACCCAGGAGTTC -3'
(R):5'- TCATCAAGGGACGCCATG -3'
Posted On2014-10-15