Incidental Mutation 'R2245:Csnk1d'
ID240638
Institutional Source Beutler Lab
Gene Symbol Csnk1d
Ensembl Gene ENSMUSG00000025162
Gene Namecasein kinase 1, delta
Synonyms
MMRRC Submission 040245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2245 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120961749-120991330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120972403 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 237 (I237T)
Ref Sequence ENSEMBL: ENSMUSP00000070721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575]
Predicted Effect probably damaging
Transcript: ENSMUST00000018274
AA Change: I237T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162
AA Change: I237T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070575
AA Change: I237T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162
AA Change: I237T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141071
Predicted Effect probably benign
Transcript: ENSMUST00000146837
SMART Domains Protein: ENSMUSP00000115055
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase 2 55 6.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154483
SMART Domains Protein: ENSMUSP00000117472
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 27 210 2.5e-12 PFAM
Pfam:Pkinase 28 218 3.4e-21 PFAM
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene encodes a member of the casein kinase I (CKI) family of serine/threonine protein kinases. A highly similar human protein regulates an array of cellular processes by influencing the Wnt and hedgehog signaling pathways. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die 1.5 to 5 days after birth and fetal weight is significantly smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,450,100 Q154R probably damaging Het
Alpk2 A G 18: 65,305,163 L1520P probably benign Het
Brd1 A G 15: 88,689,860 probably null Het
Ccdc158 A G 5: 92,609,952 probably benign Het
Cep350 C A 1: 155,879,020 V1950F probably benign Het
Ddah2 T C 17: 35,061,585 L234P probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ephb1 A C 9: 101,996,774 probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myadml2 A T 11: 120,647,830 F60I probably damaging Het
Myo15 T C 11: 60,509,099 V2893A probably damaging Het
Ntn1 A G 11: 68,385,294 V276A probably benign Het
Olfr1216 A T 2: 89,013,149 I305K probably benign Het
Olfr1355 A G 10: 78,879,931 Y253C probably damaging Het
Olfr745 T A 14: 50,642,605 I102N probably damaging Het
Otof T C 5: 30,370,207 Y1962C probably damaging Het
Pcf11 T C 7: 92,665,872 probably benign Het
Polr2a A G 11: 69,735,183 S1676P unknown Het
Prpf40b A G 15: 99,305,166 probably benign Het
Ptprh T C 7: 4,573,346 D305G probably benign Het
Rdh16f2 A G 10: 127,876,276 K201E probably damaging Het
Slc19a3 T C 1: 83,013,970 Y439C possibly damaging Het
Son G T 16: 91,647,960 probably null Het
Specc1 T C 11: 62,131,887 L710P probably damaging Het
Tex15 A G 8: 33,571,496 D592G possibly damaging Het
Tmem237 A T 1: 59,108,704 D209E probably damaging Het
Vmn2r106 T C 17: 20,268,161 T659A probably benign Het
Vmn2r71 T A 7: 85,624,180 I734N probably damaging Het
Wdr7 A T 18: 63,924,909 I1270F possibly damaging Het
Other mutations in Csnk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Csnk1d APN 11 120971567 missense probably benign 0.06
IGL01905:Csnk1d APN 11 120973963 missense probably damaging 1.00
IGL02476:Csnk1d APN 11 120972512 missense probably damaging 1.00
R1971:Csnk1d UTSW 11 120972448 missense possibly damaging 0.95
R4472:Csnk1d UTSW 11 120964974 unclassified probably benign
R4767:Csnk1d UTSW 11 120969128 missense probably benign
R4809:Csnk1d UTSW 11 120963842 unclassified probably benign
R4870:Csnk1d UTSW 11 120983188 intron probably benign
R6522:Csnk1d UTSW 11 120971623 missense probably damaging 1.00
R6657:Csnk1d UTSW 11 120964994 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTCTCTCCTGGGCAAAAGTG -3'
(R):5'- AGACACATATGCCATCCCTG -3'

Sequencing Primer
(F):5'- GCCATCTTCATATGTAAGTACCCAC -3'
(R):5'- ACATATGCCATCCCTGACATAGTTTC -3'
Posted On2014-10-15