Incidental Mutation 'R2241:Yme1l1'
ID240650
Institutional Source Beutler Lab
Gene Symbol Yme1l1
Ensembl Gene ENSMUSG00000026775
Gene NameYME1-like 1 (S. cerevisiae)
SynonymsATP-dependent metalloprotease FtsH1, Ftsh
MMRRC Submission 040241-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location23156369-23199260 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 23196900 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 673 (R673*)
Ref Sequence ENSEMBL: ENSMUSP00000028117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028117]
Predicted Effect probably null
Transcript: ENSMUST00000028117
AA Change: R673*
SMART Domains Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775
AA Change: R673*

DomainStartEndE-ValueType
AAA 313 450 4.77e-23 SMART
Pfam:Peptidase_M41 508 706 5.8e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134342
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null embryos die prior to E13.5, and show a developmental delay from E8.5 to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 G T 15: 64,699,381 L1138I possibly damaging Het
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Cyb5b A G 8: 107,170,413 D105G probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga4 T A 2: 79,301,013 I575N probably damaging Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Lrch3 A G 16: 32,995,841 T151A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr467 T C 7: 107,814,833 V83A possibly damaging Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Olfr912 A G 9: 38,581,805 H176R probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Other mutations in Yme1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Yme1l1 APN 2 23192500 missense probably benign 0.00
IGL01764:Yme1l1 APN 2 23162544 missense probably benign 0.00
IGL03289:Yme1l1 APN 2 23160268 missense probably benign
R0043:Yme1l1 UTSW 2 23187803 missense probably damaging 0.97
R0540:Yme1l1 UTSW 2 23192515 missense possibly damaging 0.68
R0583:Yme1l1 UTSW 2 23186250 missense probably damaging 1.00
R0661:Yme1l1 UTSW 2 23191042 missense probably damaging 0.96
R0673:Yme1l1 UTSW 2 23168288 missense probably benign 0.03
R2154:Yme1l1 UTSW 2 23162508 missense probably damaging 0.99
R2270:Yme1l1 UTSW 2 23175220 missense possibly damaging 0.53
R2345:Yme1l1 UTSW 2 23194786 missense probably damaging 1.00
R3837:Yme1l1 UTSW 2 23191080 missense possibly damaging 0.69
R4344:Yme1l1 UTSW 2 23173061 missense probably benign 0.02
R4368:Yme1l1 UTSW 2 23160211 missense possibly damaging 0.81
R4412:Yme1l1 UTSW 2 23175187 missense probably damaging 1.00
R4470:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4472:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4934:Yme1l1 UTSW 2 23168321 nonsense probably null
R5033:Yme1l1 UTSW 2 23194747 missense probably damaging 1.00
R5388:Yme1l1 UTSW 2 23162557 missense probably benign 0.01
R5389:Yme1l1 UTSW 2 23193234 missense probably damaging 1.00
R5943:Yme1l1 UTSW 2 23168330 missense probably damaging 0.96
R5947:Yme1l1 UTSW 2 23195306 intron probably benign
R6243:Yme1l1 UTSW 2 23193172 missense probably benign 0.00
R6724:Yme1l1 UTSW 2 23194762 missense probably damaging 1.00
R6891:Yme1l1 UTSW 2 23195389 missense probably damaging 0.99
R7016:Yme1l1 UTSW 2 23186355 intron probably null
R7565:Yme1l1 UTSW 2 23160220 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAGGCAAAGGCTCTTTTGAAAC -3'
(R):5'- TGTTGCAAAGGAGACTGCAG -3'

Sequencing Primer
(F):5'- GGCAAAGGCTCTTTTGAAACATTTTC -3'
(R):5'- GGAGACTGCAGGACTAAGTATATTC -3'
Posted On2014-10-15