Incidental Mutation 'R2241:Itga4'
ID240651
Institutional Source Beutler Lab
Gene Symbol Itga4
Ensembl Gene ENSMUSG00000027009
Gene Nameintegrin alpha 4
SynonymsVLA-4 receptor, alpha 4 subunit
MMRRC Submission 040241-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location79255426-79333123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79301013 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 575 (I575N)
Ref Sequence ENSEMBL: ENSMUSP00000099718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099972]
Predicted Effect probably damaging
Transcript: ENSMUST00000099972
AA Change: I575N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: I575N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Int_alpha 48 108 5.14e-7 SMART
Int_alpha 191 241 3.45e1 SMART
Int_alpha 247 300 1.89e-5 SMART
Int_alpha 302 358 2.25e-12 SMART
Int_alpha 364 419 1.45e-15 SMART
Int_alpha 426 483 4.52e-3 SMART
SCOP:d1m1xa2 627 770 1e-35 SMART
Blast:Int_alpha 639 676 9e-16 BLAST
SCOP:d1m1xa3 773 948 7e-42 SMART
transmembrane domain 978 1000 N/A INTRINSIC
PDB:4HKC|B 1003 1032 1e-13 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 G T 15: 64,699,381 L1138I possibly damaging Het
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Cyb5b A G 8: 107,170,413 D105G probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Lrch3 A G 16: 32,995,841 T151A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr467 T C 7: 107,814,833 V83A possibly damaging Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Olfr912 A G 9: 38,581,805 H176R probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Yme1l1 C T 2: 23,196,900 R673* probably null Het
Other mutations in Itga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Itga4 APN 2 79292050 missense probably benign 0.01
IGL01317:Itga4 APN 2 79322661 nonsense probably null
IGL01545:Itga4 APN 2 79315970 splice site probably benign
IGL01570:Itga4 APN 2 79322634 critical splice acceptor site probably null
IGL01575:Itga4 APN 2 79288255 missense probably damaging 1.00
IGL01837:Itga4 APN 2 79315005 missense probably damaging 1.00
IGL01974:Itga4 APN 2 79273127 splice site probably benign
IGL02087:Itga4 APN 2 79292069 missense probably damaging 0.99
IGL02245:Itga4 APN 2 79320559 missense probably benign 0.01
IGL02492:Itga4 APN 2 79255657 utr 5 prime probably benign
IGL02809:Itga4 APN 2 79280577 missense probably damaging 1.00
IGL02998:Itga4 APN 2 79277821 missense possibly damaging 0.88
IGL03008:Itga4 APN 2 79325638 missense probably benign
IGL03282:Itga4 APN 2 79325594 missense probably damaging 0.98
IGL03285:Itga4 APN 2 79279166 missense possibly damaging 0.48
IGL03286:Itga4 APN 2 79289362 missense probably damaging 1.00
R0001:Itga4 UTSW 2 79326587 missense probably damaging 0.99
R0045:Itga4 UTSW 2 79301031 missense probably damaging 1.00
R0276:Itga4 UTSW 2 79321493 missense probably damaging 0.99
R0554:Itga4 UTSW 2 79279117 missense probably damaging 1.00
R0556:Itga4 UTSW 2 79325639 missense probably benign
R0785:Itga4 UTSW 2 79289305 missense possibly damaging 0.89
R0787:Itga4 UTSW 2 79279153 missense probably benign 0.01
R1013:Itga4 UTSW 2 79320503 missense probably benign 0.00
R1237:Itga4 UTSW 2 79279146 missense probably null 0.08
R1295:Itga4 UTSW 2 79322689 missense possibly damaging 0.82
R1471:Itga4 UTSW 2 79287032 missense probably benign 0.26
R1559:Itga4 UTSW 2 79315688 missense probably benign 0.04
R1769:Itga4 UTSW 2 79315706 critical splice donor site probably null
R1931:Itga4 UTSW 2 79313844 critical splice donor site probably null
R2012:Itga4 UTSW 2 79277794 missense probably damaging 1.00
R3793:Itga4 UTSW 2 79279128 missense probably benign 0.01
R4133:Itga4 UTSW 2 79322652 missense probably damaging 1.00
R4204:Itga4 UTSW 2 79279161 missense probably damaging 0.97
R4296:Itga4 UTSW 2 79272799 missense probably damaging 1.00
R4777:Itga4 UTSW 2 79313710 missense possibly damaging 0.87
R4906:Itga4 UTSW 2 79288248 missense probably damaging 1.00
R5048:Itga4 UTSW 2 79273034 missense probably benign 0.04
R5087:Itga4 UTSW 2 79315629 missense possibly damaging 0.95
R5212:Itga4 UTSW 2 79280595 missense probably damaging 1.00
R5213:Itga4 UTSW 2 79320576 missense probably benign 0.29
R5421:Itga4 UTSW 2 79316041 nonsense probably null
R5549:Itga4 UTSW 2 79256267 missense probably damaging 0.98
R5907:Itga4 UTSW 2 79322656 missense probably benign
R5917:Itga4 UTSW 2 79287098 missense probably damaging 1.00
R6309:Itga4 UTSW 2 79279085 missense probably damaging 1.00
R6764:Itga4 UTSW 2 79325614 missense probably benign 0.02
R6787:Itga4 UTSW 2 79289265 missense probably damaging 0.97
R6790:Itga4 UTSW 2 79325614 missense probably benign 0.02
R7051:Itga4 UTSW 2 79318126 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGGACCTTTGGGATAGCGTT -3'
(R):5'- AGGTACTCATGTGACTAAATGCAA -3'

Sequencing Primer
(F):5'- ACCTTTGGGATAGCGTTGAAAATG -3'
(R):5'- ATATTCAACTGAACATCCCAAAGG -3'
Posted On2014-10-15