Incidental Mutation 'R2241:Adcy8'
ID240676
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
MMRRC Submission 040241-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64699381 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 1138 (L1138I)
Ref Sequence ENSEMBL: ENSMUSP00000154029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect probably benign
Transcript: ENSMUST00000023007
AA Change: L1168I

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: L1168I

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228014
AA Change: L1138I

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Cyb5b A G 8: 107,170,413 D105G probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga4 T A 2: 79,301,013 I575N probably damaging Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Lrch3 A G 16: 32,995,841 T151A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr467 T C 7: 107,814,833 V83A possibly damaging Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Olfr912 A G 9: 38,581,805 H176R probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Yme1l1 C T 2: 23,196,900 R673* probably null Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GTCAGTGCCTTCAGCTTGTG -3'
(R):5'- AACTGTGAACTTGGCAAGCC -3'

Sequencing Primer
(F):5'- CAAAGTCCGCCGGTTGTAATG -3'
(R):5'- CTGTGAACTTGGCAAGCCGAATG -3'
Posted On2014-10-15