Incidental Mutation 'R2241:Lrch3'
ID240677
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms2210409B11Rik, LOC385628
MMRRC Submission 040241-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32914100-33015647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32995841 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 151 (T151A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000165616] [ENSMUST00000165826] [ENSMUST00000170201] [ENSMUST00000170899]
Predicted Effect probably benign
Transcript: ENSMUST00000023491
AA Change: T598A

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801
AA Change: T598A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably benign
Transcript: ENSMUST00000135193
AA Change: T598A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801
AA Change: T598A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142290
AA Change: T151A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117302
Gene: ENSMUSG00000022801
AA Change: T151A

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
SCOP:d1h67a_ 201 253 1e-11 SMART
Blast:CH 205 253 6e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000163428
AA Change: T180A

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801
AA Change: T180A

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165616
AA Change: T444A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801
AA Change: T444A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170201
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170899
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 G T 15: 64,699,381 L1138I possibly damaging Het
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Cyb5b A G 8: 107,170,413 D105G probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga4 T A 2: 79,301,013 I575N probably damaging Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr467 T C 7: 107,814,833 V83A possibly damaging Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Olfr912 A G 9: 38,581,805 H176R probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Yme1l1 C T 2: 23,196,900 R673* probably null Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32994965 missense probably benign 0.10
IGL01400:Lrch3 APN 16 32979541 missense probably damaging 1.00
IGL02565:Lrch3 APN 16 33005714 missense probably benign 0.00
IGL03076:Lrch3 APN 16 32981853 missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32952137 missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32914277 missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32955324 missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32995852 intron probably benign
R0123:Lrch3 UTSW 16 32961754 splice site probably benign
R0225:Lrch3 UTSW 16 32961754 splice site probably benign
R0326:Lrch3 UTSW 16 32979500 missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32986880 missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32997483 nonsense probably null
R1204:Lrch3 UTSW 16 33009214 missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32988495 splice site probably benign
R1526:Lrch3 UTSW 16 32950376 missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32950411 nonsense probably null
R1850:Lrch3 UTSW 16 32986793 missense probably benign 0.01
R1966:Lrch3 UTSW 16 32914385 missense possibly damaging 0.94
R2313:Lrch3 UTSW 16 32961675 missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32950396 missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32988484 splice site probably null
R4795:Lrch3 UTSW 16 33005704 missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32914397 missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32975807 missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32985965 unclassified probably null
R5470:Lrch3 UTSW 16 32998590 missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32914184 missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32998526 missense probably damaging 1.00
R5862:Lrch3 UTSW 16 32995809 missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32959463 missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32975736 missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32994997 critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32950420 missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32993779 missense probably benign 0.05
R7197:Lrch3 UTSW 16 32990295 missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32994993 missense probably benign 0.19
R7392:Lrch3 UTSW 16 32986755 nonsense probably null
R7408:Lrch3 UTSW 16 32986743 nonsense probably null
R7414:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R7425:Lrch3 UTSW 16 33005707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGCTTTACTGTTTACATACGC -3'
(R):5'- TTAATGTTAGCGAGGTCACAGACAC -3'

Sequencing Primer
(F):5'- CGCTTTTCATTAACGAGTAGACTC -3'
(R):5'- GTCACAGACACCTGCAGAGTTAG -3'
Posted On2014-10-15