Incidental Mutation 'R0164:Tomm70a'
ID24071
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Nametranslocase of outer mitochondrial membrane 70A
SynonymsTomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R0164 (G1)
Quality Score215
Status Validated (trace)
Chromosome16
Chromosomal Location57121703-57156705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57147821 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 517 (V517A)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166897]
Predicted Effect probably damaging
Transcript: ENSMUST00000166897
AA Change: V517A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: V517A

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf1 T A 9: 106,844,145 S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Klc3 T A 7: 19,394,926 N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tcp1 T A 17: 12,922,747 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 P631S possibly damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Ulk3 T A 9: 57,590,686 I90N probably damaging Het
Unc13c T C 9: 73,694,892 I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57149810 splice site probably benign
IGL01064:Tomm70a APN 16 57152612 missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57133188 missense probably benign 0.00
IGL02248:Tomm70a APN 16 57138102 missense probably benign 0.33
IGL02560:Tomm70a APN 16 57149849 missense probably benign 0.33
IGL03328:Tomm70a APN 16 57144787 missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57149926 missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0196:Tomm70a UTSW 16 57146100 missense probably benign 0.03
R0417:Tomm70a UTSW 16 57149903 missense probably benign 0.28
R0763:Tomm70a UTSW 16 57122172 missense probably benign 0.30
R1099:Tomm70a UTSW 16 57142817 missense probably damaging 1.00
R1680:Tomm70a UTSW 16 57121961 missense unknown
R2081:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57121871 missense unknown
R3033:Tomm70a UTSW 16 57122025 missense probably damaging 1.00
R4287:Tomm70a UTSW 16 57140622 missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57122151 missense probably benign
R5210:Tomm70a UTSW 16 57133251 critical splice donor site probably null
R5214:Tomm70a UTSW 16 57121937 missense unknown
R5586:Tomm70a UTSW 16 57122130 missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57121839 start gained probably benign
R5872:Tomm70a UTSW 16 57144742 missense probably benign 0.06
R6256:Tomm70a UTSW 16 57152692 missense probably benign 0.05
R6699:Tomm70a UTSW 16 57142802 missense probably benign 0.02
R6902:Tomm70a UTSW 16 57138081 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCACAGCAGTAGCAGTTTCC -3'
(R):5'- GCAGACTGTCTCAAACAAGGTAGAACG -3'

Sequencing Primer
(F):5'- GCTGTCATTAAAAGTAGGCTCTTCTG -3'
(R):5'- acacagatatcacaaagatatgcac -3'
Posted On2013-04-16