Incidental Mutation 'R2242:Afap1l2'
ID240711
Institutional Source Beutler Lab
Gene Symbol Afap1l2
Ensembl Gene ENSMUSG00000025083
Gene Nameactin filament associated protein 1-like 2
Synonyms
MMRRC Submission 040242-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2242 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56912361-57008228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56914468 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 760 (I760V)
Ref Sequence ENSEMBL: ENSMUSP00000107210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111584
AA Change: I760V

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: I760V

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
AA Change: I742V

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: I742V

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
AA Change: I686V

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: I686V

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,689,341 S630T probably benign Het
Cdc20 A G 4: 118,433,525 V426A probably benign Het
Clca2 T C 3: 145,090,790 S219G probably damaging Het
Corin A T 5: 72,332,711 D603E probably damaging Het
Dctn1 A G 6: 83,199,705 Y1205C probably damaging Het
Dync2h1 A T 9: 7,037,828 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Fes T G 7: 80,381,725 E467A probably damaging Het
Ftsj3 T A 11: 106,250,778 Q548L probably benign Het
Gpc6 A T 14: 117,186,787 T96S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lama4 G A 10: 39,026,693 C221Y probably damaging Het
Malrd1 T C 2: 16,101,944 C1856R unknown Het
Mfsd6 G T 1: 52,709,598 P36Q probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr133 A G 17: 38,148,722 I45V possibly damaging Het
Olfr273 A G 4: 52,855,769 V248A probably damaging Het
Ripor2 A G 13: 24,671,772 E65G probably benign Het
Sardh A T 2: 27,235,515 V329E possibly damaging Het
Slc37a3 A G 6: 39,338,805 S446P probably benign Het
Vmn2r57 T C 7: 41,428,074 T223A probably benign Het
Wdr47 A G 3: 108,619,115 D318G probably damaging Het
Zic4 C T 9: 91,378,653 probably benign Het
Other mutations in Afap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Afap1l2 APN 19 57002308 splice site probably benign
IGL01012:Afap1l2 APN 19 56930261 missense probably damaging 0.98
IGL01089:Afap1l2 APN 19 56913411 splice site probably null
IGL01150:Afap1l2 APN 19 56930186 missense probably damaging 0.99
IGL02393:Afap1l2 APN 19 56914440 missense probably damaging 1.00
IGL02887:Afap1l2 APN 19 56920563 missense probably damaging 1.00
IGL03060:Afap1l2 APN 19 56914250 nonsense probably null
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0282:Afap1l2 UTSW 19 56916221 missense possibly damaging 0.65
R0388:Afap1l2 UTSW 19 56917242 splice site probably benign
R0432:Afap1l2 UTSW 19 56917119 splice site probably benign
R0497:Afap1l2 UTSW 19 56930209 missense probably benign 0.27
R0578:Afap1l2 UTSW 19 56915782 missense probably benign 0.04
R0631:Afap1l2 UTSW 19 56916085 missense probably benign 0.39
R0670:Afap1l2 UTSW 19 56915803 missense probably damaging 1.00
R1188:Afap1l2 UTSW 19 56925069 missense probably damaging 0.97
R1236:Afap1l2 UTSW 19 56916472 missense possibly damaging 0.64
R1274:Afap1l2 UTSW 19 56914563 missense probably benign 0.02
R1463:Afap1l2 UTSW 19 56930151 missense probably benign 0.01
R1497:Afap1l2 UTSW 19 56928311 missense probably benign 0.25
R1597:Afap1l2 UTSW 19 56914449 missense probably benign 0.14
R1778:Afap1l2 UTSW 19 56916206 missense possibly damaging 0.68
R1795:Afap1l2 UTSW 19 56928409 missense probably damaging 1.00
R1991:Afap1l2 UTSW 19 57002267 missense possibly damaging 0.62
R2113:Afap1l2 UTSW 19 56913389 missense possibly damaging 0.95
R3429:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3430:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3698:Afap1l2 UTSW 19 56916523 missense possibly damaging 0.69
R4706:Afap1l2 UTSW 19 56937240 missense possibly damaging 0.76
R4956:Afap1l2 UTSW 19 56943447 missense probably benign 0.00
R4993:Afap1l2 UTSW 19 56918040 missense probably damaging 1.00
R5772:Afap1l2 UTSW 19 56922974 missense probably benign 0.02
R5878:Afap1l2 UTSW 19 56915675 missense probably benign 0.01
R6194:Afap1l2 UTSW 19 56922951 missense probably damaging 1.00
R6226:Afap1l2 UTSW 19 56916128 missense probably benign 0.00
R6334:Afap1l2 UTSW 19 56917976 unclassified probably null
R6439:Afap1l2 UTSW 19 56928386 missense possibly damaging 0.91
R7332:Afap1l2 UTSW 19 56918121 missense probably damaging 1.00
X0062:Afap1l2 UTSW 19 56918033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGACTGGGTCAAATTACTATG -3'
(R):5'- CCATTTAATGTGCACAGGGC -3'

Sequencing Primer
(F):5'- TGTATATAAAACCCACCTCTACCAC -3'
(R):5'- ATAGGAGCCCATGGACGTCATTC -3'
Posted On2014-10-15