Incidental Mutation 'R2249:Cp'
ID240767
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2249 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19987570 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 953 (M953T)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329] [ENSMUST00000173779] [ENSMUST00000173848]
Predicted Effect probably damaging
Transcript: ENSMUST00000003714
AA Change: M952T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: M952T

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091309
AA Change: M953T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: M953T

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108325
AA Change: M952T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: M952T

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108328
AA Change: M952T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: M952T

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108329
AA Change: M953T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: M953T

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect probably benign
Transcript: ENSMUST00000172605
SMART Domains Protein: ENSMUSP00000134347
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
PDB:1KCW|A 2 58 2e-28 PDB
SCOP:d1kcw_5 22 58 4e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172860
AA Change: M89T
SMART Domains Protein: ENSMUSP00000133374
Gene: ENSMUSG00000003617
AA Change: M89T

DomainStartEndE-ValueType
Pfam:Cu-oxidase 53 192 1.4e-6 PFAM
Pfam:Cu-oxidase_2 66 192 4.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173779
SMART Domains Protein: ENSMUSP00000133643
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
SCOP:d1gw0a3 1 37 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173848
SMART Domains Protein: ENSMUSP00000133676
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 16 93 1e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Adam23 C T 1: 63,535,176 Q276* probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cd34 A C 1: 194,947,952 T65P possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Neto1 G T 18: 86,461,274 A196S probably benign Het
Notum A G 11: 120,654,411 F441L probably benign Het
Nsmce4a A G 7: 130,539,039 I239T probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr619 T A 7: 103,603,736 D27E probably benign Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7336:Cp UTSW 3 19964532 splice site probably null
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCAGGATCTCTATAGTGGGC -3'
(R):5'- AGAGCCTTAATCCTGATTGCAG -3'

Sequencing Primer
(F):5'- CAGGATCTCTATAGTGGGCTAATAG -3'
(R):5'- CCTGATTGCAGATTTACTTAGAAGGG -3'
Posted On2014-10-15