Incidental Mutation 'R2250:Spta1'
ID 240817
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Name spectrin alpha, erythrocytic 1
Synonyms erythroid, Spna-1, ihj, Spna1
MMRRC Submission 040250-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.854) question?
Stock # R2250 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 174000342-174076016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 174071680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2220 (E2220G)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000214725]
AlphaFold P08032
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: E2220G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: E2220G

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Predicted Effect probably benign
Transcript: ENSMUST00000214725
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,342,765 (GRCm39) C532R probably damaging Het
Edem2 A C 2: 155,552,893 (GRCm39) probably null Het
Hhatl A G 9: 121,617,237 (GRCm39) V332A possibly damaging Het
Igsf9b G A 9: 27,220,774 (GRCm39) V47I possibly damaging Het
Irf2bp1 G T 7: 18,739,724 (GRCm39) A455S probably benign Het
Lyg2 G A 1: 37,954,816 (GRCm39) L10F probably benign Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mindy4 G A 6: 55,277,934 (GRCm39) V593I probably damaging Het
Nectin3 A T 16: 46,275,099 (GRCm39) D319E probably benign Het
Or52e2 C A 7: 102,804,157 (GRCm39) G266C probably damaging Het
Or6b9 T A 7: 106,555,580 (GRCm39) M188L probably benign Het
Plcb4 G A 2: 135,813,781 (GRCm39) probably null Het
Prkd3 T C 17: 79,275,507 (GRCm39) T446A probably benign Het
Scn11a T A 9: 119,587,668 (GRCm39) T1359S probably benign Het
Skp1 T C 11: 52,134,446 (GRCm39) I59T possibly damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Strn4 A G 7: 16,560,391 (GRCm39) Y181C probably damaging Het
Vmn1r119 A T 7: 20,746,184 (GRCm39) L66H probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174,035,956 (GRCm39) nonsense probably null
IGL01095:Spta1 APN 1 174,041,051 (GRCm39) missense probably benign 0.02
IGL01144:Spta1 APN 1 174,014,829 (GRCm39) missense probably benign 0.05
IGL01455:Spta1 APN 1 174,030,877 (GRCm39) missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174,044,725 (GRCm39) missense probably benign 0.03
IGL01613:Spta1 APN 1 174,035,960 (GRCm39) missense probably damaging 1.00
IGL01804:Spta1 APN 1 174,071,746 (GRCm39) missense probably benign 0.42
IGL01859:Spta1 APN 1 174,001,938 (GRCm39) missense probably damaging 1.00
IGL01898:Spta1 APN 1 174,041,428 (GRCm39) missense probably benign 0.00
IGL02106:Spta1 APN 1 174,030,860 (GRCm39) missense probably benign 0.02
IGL02166:Spta1 APN 1 174,017,797 (GRCm39) missense probably damaging 1.00
IGL02224:Spta1 APN 1 174,045,255 (GRCm39) critical splice donor site probably benign
IGL02318:Spta1 APN 1 174,002,029 (GRCm39) missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174,046,380 (GRCm39) missense probably damaging 0.96
IGL02852:Spta1 APN 1 174,071,676 (GRCm39) missense probably benign 0.24
IGL02861:Spta1 APN 1 174,039,164 (GRCm39) missense probably damaging 1.00
IGL02982:Spta1 APN 1 174,014,854 (GRCm39) missense probably benign 0.00
IGL03057:Spta1 APN 1 174,008,624 (GRCm39) missense probably benign 0.19
IGL03215:Spta1 APN 1 174,046,309 (GRCm39) missense probably damaging 1.00
IGL03263:Spta1 APN 1 174,041,484 (GRCm39) missense probably damaging 0.99
IGL03272:Spta1 APN 1 174,041,710 (GRCm39) missense probably benign 0.08
bounced UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
Capillus UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
Deflection UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
Goldfoil UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
hanging UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
Klimt UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
Rutherford UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
Thread UTSW 1 174,025,201 (GRCm39) nonsense probably null
H8786:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0078:Spta1 UTSW 1 174,034,598 (GRCm39) splice site probably benign
R0172:Spta1 UTSW 1 174,058,352 (GRCm39) missense probably damaging 1.00
R0206:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0208:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0276:Spta1 UTSW 1 174,045,460 (GRCm39) missense probably damaging 1.00
R0288:Spta1 UTSW 1 174,070,745 (GRCm39) missense probably damaging 0.99
R0323:Spta1 UTSW 1 174,046,017 (GRCm39) missense probably damaging 1.00
R0454:Spta1 UTSW 1 174,041,508 (GRCm39) missense probably damaging 1.00
R0508:Spta1 UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
R0698:Spta1 UTSW 1 174,008,670 (GRCm39) missense probably damaging 1.00
R0751:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R0925:Spta1 UTSW 1 174,001,992 (GRCm39) missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174,072,771 (GRCm39) unclassified probably benign
R1131:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R1171:Spta1 UTSW 1 174,039,180 (GRCm39) nonsense probably null
R1184:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R1401:Spta1 UTSW 1 174,050,250 (GRCm39) missense probably damaging 1.00
R1489:Spta1 UTSW 1 174,058,891 (GRCm39) missense probably damaging 0.97
R1532:Spta1 UTSW 1 174,074,919 (GRCm39) missense probably damaging 0.99
R1551:Spta1 UTSW 1 174,067,732 (GRCm39) missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
R1566:Spta1 UTSW 1 174,012,272 (GRCm39) missense probably benign 0.00
R1586:Spta1 UTSW 1 174,041,061 (GRCm39) missense probably benign 0.00
R1676:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R1711:Spta1 UTSW 1 174,068,608 (GRCm39) missense probably damaging 1.00
R1795:Spta1 UTSW 1 174,073,296 (GRCm39) missense probably damaging 1.00
R1823:Spta1 UTSW 1 174,074,115 (GRCm39) missense probably benign 0.05
R1842:Spta1 UTSW 1 174,023,513 (GRCm39) missense probably benign 0.00
R1867:Spta1 UTSW 1 174,047,405 (GRCm39) missense probably benign 0.33
R1970:Spta1 UTSW 1 174,067,933 (GRCm39) missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174,039,213 (GRCm39) missense probably benign 0.20
R2095:Spta1 UTSW 1 174,071,764 (GRCm39) missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174,035,910 (GRCm39) missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174,040,180 (GRCm39) missense probably benign 0.00
R2158:Spta1 UTSW 1 174,056,824 (GRCm39) missense probably benign 0.41
R2187:Spta1 UTSW 1 174,020,532 (GRCm39) missense probably damaging 1.00
R2258:Spta1 UTSW 1 174,001,907 (GRCm39) missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174,006,222 (GRCm39) critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R4058:Spta1 UTSW 1 174,068,703 (GRCm39) missense probably damaging 1.00
R4080:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4081:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4082:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4108:Spta1 UTSW 1 174,002,122 (GRCm39) missense probably benign 0.01
R4115:Spta1 UTSW 1 174,067,923 (GRCm39) missense probably damaging 1.00
R4303:Spta1 UTSW 1 174,007,418 (GRCm39) missense probably damaging 1.00
R4419:Spta1 UTSW 1 174,074,990 (GRCm39) nonsense probably null
R4525:Spta1 UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
R4614:Spta1 UTSW 1 174,020,543 (GRCm39) missense probably damaging 1.00
R4673:Spta1 UTSW 1 174,018,628 (GRCm39) splice site probably null
R4782:Spta1 UTSW 1 174,058,232 (GRCm39) missense probably benign 0.01
R4825:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174,065,493 (GRCm39) missense probably benign 0.01
R4873:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4875:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4898:Spta1 UTSW 1 174,065,400 (GRCm39) missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174,045,429 (GRCm39) splice site probably null
R4911:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R4928:Spta1 UTSW 1 174,018,622 (GRCm39) missense probably benign 0.15
R4959:Spta1 UTSW 1 174,074,174 (GRCm39) missense probably damaging 0.97
R5009:Spta1 UTSW 1 174,067,789 (GRCm39) missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174,075,000 (GRCm39) missense probably damaging 0.99
R5293:Spta1 UTSW 1 174,023,551 (GRCm39) missense probably damaging 0.99
R5421:Spta1 UTSW 1 174,043,095 (GRCm39) missense probably damaging 0.99
R5457:Spta1 UTSW 1 174,044,759 (GRCm39) missense probably damaging 1.00
R5590:Spta1 UTSW 1 174,003,336 (GRCm39) missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174,047,468 (GRCm39) missense probably damaging 1.00
R5736:Spta1 UTSW 1 174,041,821 (GRCm39) critical splice donor site probably null
R5834:Spta1 UTSW 1 174,012,363 (GRCm39) splice site probably null
R5845:Spta1 UTSW 1 174,068,662 (GRCm39) missense probably damaging 0.97
R5987:Spta1 UTSW 1 174,050,894 (GRCm39) missense probably damaging 1.00
R6102:Spta1 UTSW 1 174,052,086 (GRCm39) missense probably benign 0.01
R6221:Spta1 UTSW 1 174,009,342 (GRCm39) missense probably damaging 1.00
R6276:Spta1 UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
R6317:Spta1 UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
R6329:Spta1 UTSW 1 174,041,743 (GRCm39) missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174,039,212 (GRCm39) missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174,041,734 (GRCm39) missense probably damaging 1.00
R6376:Spta1 UTSW 1 174,030,888 (GRCm39) missense probably benign
R6387:Spta1 UTSW 1 174,058,899 (GRCm39) missense probably benign 0.01
R6451:Spta1 UTSW 1 174,044,767 (GRCm39) missense probably damaging 0.97
R6480:Spta1 UTSW 1 174,014,714 (GRCm39) splice site probably null
R6533:Spta1 UTSW 1 174,071,713 (GRCm39) missense probably damaging 1.00
R6585:Spta1 UTSW 1 174,006,251 (GRCm39) missense probably damaging 1.00
R6695:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174,036,891 (GRCm39) missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174,036,918 (GRCm39) missense probably damaging 1.00
R7086:Spta1 UTSW 1 174,027,050 (GRCm39) missense probably damaging 0.98
R7087:Spta1 UTSW 1 174,002,076 (GRCm39) missense probably benign
R7151:Spta1 UTSW 1 174,025,317 (GRCm39) missense probably damaging 1.00
R7193:Spta1 UTSW 1 174,012,178 (GRCm39) missense probably damaging 1.00
R7199:Spta1 UTSW 1 174,050,837 (GRCm39) missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174,050,203 (GRCm39) missense probably damaging 0.96
R7343:Spta1 UTSW 1 174,050,915 (GRCm39) missense probably damaging 0.99
R7372:Spta1 UTSW 1 174,025,201 (GRCm39) nonsense probably null
R7472:Spta1 UTSW 1 174,074,065 (GRCm39) missense probably damaging 1.00
R7516:Spta1 UTSW 1 174,025,349 (GRCm39) missense probably damaging 1.00
R7627:Spta1 UTSW 1 174,032,944 (GRCm39) missense probably damaging 1.00
R7770:Spta1 UTSW 1 174,023,547 (GRCm39) nonsense probably null
R7784:Spta1 UTSW 1 174,030,017 (GRCm39) missense probably damaging 1.00
R7804:Spta1 UTSW 1 174,023,471 (GRCm39) missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174,046,396 (GRCm39) critical splice donor site probably null
R7862:Spta1 UTSW 1 174,025,351 (GRCm39) critical splice donor site probably null
R7958:Spta1 UTSW 1 174,001,956 (GRCm39) missense probably benign 0.03
R8015:Spta1 UTSW 1 174,067,737 (GRCm39) missense probably damaging 1.00
R8059:Spta1 UTSW 1 174,045,936 (GRCm39) intron probably benign
R8076:Spta1 UTSW 1 174,014,797 (GRCm39) missense probably benign 0.00
R8152:Spta1 UTSW 1 174,045,510 (GRCm39) missense probably benign 0.03
R8235:Spta1 UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
R8284:Spta1 UTSW 1 174,007,387 (GRCm39) missense probably benign 0.00
R8298:Spta1 UTSW 1 174,074,953 (GRCm39) missense probably damaging 1.00
R8312:Spta1 UTSW 1 174,067,777 (GRCm39) missense probably damaging 1.00
R8495:Spta1 UTSW 1 174,043,051 (GRCm39) missense probably benign 0.00
R8550:Spta1 UTSW 1 174,014,774 (GRCm39) missense probably damaging 1.00
R8675:Spta1 UTSW 1 174,058,249 (GRCm39) missense probably benign 0.01
R8757:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8759:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8848:Spta1 UTSW 1 174,025,310 (GRCm39) missense probably benign 0.05
R8883:Spta1 UTSW 1 174,021,145 (GRCm39) missense possibly damaging 0.82
R8884:Spta1 UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
R8896:Spta1 UTSW 1 174,045,548 (GRCm39) missense probably damaging 1.00
R8953:Spta1 UTSW 1 174,058,241 (GRCm39) missense probably benign 0.10
R9006:Spta1 UTSW 1 174,047,537 (GRCm39) missense probably damaging 1.00
R9013:Spta1 UTSW 1 174,050,174 (GRCm39) missense probably damaging 1.00
R9077:Spta1 UTSW 1 174,045,170 (GRCm39) missense probably damaging 1.00
R9129:Spta1 UTSW 1 174,058,911 (GRCm39) missense possibly damaging 0.77
R9207:Spta1 UTSW 1 174,039,139 (GRCm39) missense probably benign 0.01
R9229:Spta1 UTSW 1 174,067,750 (GRCm39) missense probably damaging 1.00
R9281:Spta1 UTSW 1 174,047,444 (GRCm39) missense probably damaging 1.00
R9290:Spta1 UTSW 1 174,045,204 (GRCm39) missense possibly damaging 0.94
R9307:Spta1 UTSW 1 174,035,978 (GRCm39) missense probably damaging 1.00
R9489:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9605:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9685:Spta1 UTSW 1 174,032,925 (GRCm39) missense probably damaging 1.00
RF002:Spta1 UTSW 1 174,058,926 (GRCm39) missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174,036,885 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,045,469 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,041,010 (GRCm39) missense probably benign 0.42
T0722:Spta1 UTSW 1 174,018,632 (GRCm39) splice site probably benign
X0028:Spta1 UTSW 1 174,052,016 (GRCm39) missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174,067,933 (GRCm39) missense probably damaging 0.99
Z1176:Spta1 UTSW 1 174,018,617 (GRCm39) missense probably damaging 1.00
Z1177:Spta1 UTSW 1 174,073,255 (GRCm39) missense probably benign 0.02
Z1177:Spta1 UTSW 1 174,017,728 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTGAGTTCCAGGATGACAACC -3'
(R):5'- TAACGGAACATCTCTGTAAGTGC -3'

Sequencing Primer
(F):5'- CATCATCTCACAGCTGTTTTTCAAAG -3'
(R):5'- AAGTGCTCTTTATCAGGTGCC -3'
Posted On 2014-10-15