Incidental Mutation 'R2250:Vmn1r119'
ID240825
Institutional Source Beutler Lab
Gene Symbol Vmn1r119
Ensembl Gene ENSMUSG00000094010
Gene Namevomeronasal 1 receptor 119
SynonymsLOC384696, Gm1447
MMRRC Submission 040250-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2250 (G1)
Quality Score177
Status Not validated
Chromosome7
Chromosomal Location21011532-21012455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21012259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 66 (L66H)
Ref Sequence ENSEMBL: ENSMUSP00000127126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164683]
Predicted Effect probably damaging
Transcript: ENSMUST00000164683
AA Change: L66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127126
Gene: ENSMUSG00000094010
AA Change: L66H

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 7.4e-17 PFAM
Pfam:7tm_1 31 290 2.1e-7 PFAM
Pfam:V1R 41 298 2e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,451,939 C532R probably damaging Het
Edem2 A C 2: 155,710,973 probably null Het
Hhatl A G 9: 121,788,171 V332A possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Irf2bp1 G T 7: 19,005,799 A455S probably benign Het
Lyg2 G A 1: 37,915,735 L10F probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mindy4 G A 6: 55,300,949 V593I probably damaging Het
Nectin3 A T 16: 46,454,736 D319E probably benign Het
Olfr589 C A 7: 103,154,950 G266C probably damaging Het
Olfr6 T A 7: 106,956,373 M188L probably benign Het
Plcb4 G A 2: 135,971,861 probably null Het
Prkd3 T C 17: 78,968,078 T446A probably benign Het
Scn11a T A 9: 119,758,602 T1359S probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spta1 A G 1: 174,244,114 E2220G probably damaging Het
Strn4 A G 7: 16,826,466 Y181C probably damaging Het
Other mutations in Vmn1r119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Vmn1r119 APN 7 21012131 missense probably benign 0.41
IGL02218:Vmn1r119 APN 7 21011636 missense probably benign 0.11
R0639:Vmn1r119 UTSW 7 21011668 missense possibly damaging 0.70
R1844:Vmn1r119 UTSW 7 21012196 missense probably damaging 1.00
R2927:Vmn1r119 UTSW 7 21012131 missense probably benign 0.41
R4279:Vmn1r119 UTSW 7 21011861 missense probably benign 0.00
R5022:Vmn1r119 UTSW 7 21012320 missense probably benign 0.08
R6160:Vmn1r119 UTSW 7 21011815 missense possibly damaging 0.47
R6523:Vmn1r119 UTSW 7 21011852 missense possibly damaging 0.75
R7013:Vmn1r119 UTSW 7 21011789 missense probably damaging 1.00
R7218:Vmn1r119 UTSW 7 21011647 missense probably benign 0.00
R7320:Vmn1r119 UTSW 7 21012346 missense probably damaging 0.99
X0060:Vmn1r119 UTSW 7 21012283 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTTGCCATGTTTGTGACACTTG -3'
(R):5'- AATCCGTGAAAACCACTGAGG -3'

Sequencing Primer
(F):5'- GCCATGTTTGTGACACTTGCTCTAAG -3'
(R):5'- CTGTGGCCAATGTCTTTCT -3'
Posted On2014-10-15